Incidental Mutation 'R5513:2310035C23Rik'
ID484512
Institutional Source Beutler Lab
Gene Symbol 2310035C23Rik
Ensembl Gene ENSMUSG00000026319
Gene NameRIKEN cDNA 2310035C23 gene
Synonyms
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R5513 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105663861-105755191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105750973 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1130 (V1130I)
Ref Sequence ENSEMBL: ENSMUSP00000141162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]
Predicted Effect probably damaging
Transcript: ENSMUST00000039173
AA Change: V1154I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: V1154I

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086721
AA Change: V1154I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: V1154I

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 1.25e-3 SMART
coiled coil region 358 396 N/A INTRINSIC
SCOP:d1b3ua_ 556 1093 5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185692
Predicted Effect probably benign
Transcript: ENSMUST00000186807
SMART Domains Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 3.9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190459
Predicted Effect probably damaging
Transcript: ENSMUST00000190501
AA Change: V1130I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: V1130I

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Meta Mutation Damage Score 0.1133 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in 2310035C23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:2310035C23Rik APN 1 105696599 splice site probably benign
IGL02393:2310035C23Rik APN 1 105687368 missense probably damaging 1.00
IGL02655:2310035C23Rik APN 1 105678246 missense probably damaging 1.00
IGL02992:2310035C23Rik APN 1 105719464 missense possibly damaging 0.89
IGL03170:2310035C23Rik APN 1 105735955 missense probably damaging 0.99
IGL03050:2310035C23Rik UTSW 1 105726381 missense probably damaging 0.98
R0022:2310035C23Rik UTSW 1 105691902 splice site probably benign
R0399:2310035C23Rik UTSW 1 105750959 splice site probably benign
R1243:2310035C23Rik UTSW 1 105750364 missense probably damaging 1.00
R1563:2310035C23Rik UTSW 1 105719534 missense probably damaging 1.00
R1760:2310035C23Rik UTSW 1 105719444 splice site probably benign
R1894:2310035C23Rik UTSW 1 105664576 missense probably benign 0.12
R2036:2310035C23Rik UTSW 1 105743254 missense probably damaging 1.00
R2428:2310035C23Rik UTSW 1 105746126 missense possibly damaging 0.88
R2905:2310035C23Rik UTSW 1 105691994 missense probably benign 0.04
R3121:2310035C23Rik UTSW 1 105725799 missense probably benign 0.15
R3750:2310035C23Rik UTSW 1 105753577 missense probably damaging 1.00
R3886:2310035C23Rik UTSW 1 105692213 missense probably benign 0.14
R4284:2310035C23Rik UTSW 1 105721287 missense probably damaging 0.98
R4671:2310035C23Rik UTSW 1 105718859 missense probably benign 0.00
R4706:2310035C23Rik UTSW 1 105692279 missense probably benign 0.28
R4760:2310035C23Rik UTSW 1 105721305 missense probably benign 0.17
R4776:2310035C23Rik UTSW 1 105719535 nonsense probably null
R5031:2310035C23Rik UTSW 1 105664514 missense probably damaging 1.00
R5051:2310035C23Rik UTSW 1 105691986 missense possibly damaging 0.85
R5085:2310035C23Rik UTSW 1 105678180 missense probably damaging 0.99
R5104:2310035C23Rik UTSW 1 105731240 missense probably benign 0.45
R5187:2310035C23Rik UTSW 1 105718809 nonsense probably null
R5259:2310035C23Rik UTSW 1 105721376 missense probably benign 0.01
R5435:2310035C23Rik UTSW 1 105741250 intron probably benign
R5444:2310035C23Rik UTSW 1 105726384 missense possibly damaging 0.60
R5490:2310035C23Rik UTSW 1 105719501 missense probably damaging 0.99
R5556:2310035C23Rik UTSW 1 105693167 missense probably benign
R5734:2310035C23Rik UTSW 1 105703883 intron probably benign
R5779:2310035C23Rik UTSW 1 105687347 missense probably damaging 1.00
R5822:2310035C23Rik UTSW 1 105718856 missense probably damaging 1.00
R5878:2310035C23Rik UTSW 1 105692960 missense probably benign
R6015:2310035C23Rik UTSW 1 105691958 missense probably damaging 1.00
R6051:2310035C23Rik UTSW 1 105721272 missense probably damaging 1.00
R6266:2310035C23Rik UTSW 1 105731282 critical splice donor site probably null
R6556:2310035C23Rik UTSW 1 105726440 missense probably damaging 1.00
R6571:2310035C23Rik UTSW 1 105692982 missense probably benign
R6612:2310035C23Rik UTSW 1 105692007 missense possibly damaging 0.72
R6852:2310035C23Rik UTSW 1 105753595 missense probably damaging 1.00
R7209:2310035C23Rik UTSW 1 105750357 missense probably damaging 1.00
R7284:2310035C23Rik UTSW 1 105734583 missense probably benign 0.01
R7292:2310035C23Rik UTSW 1 105721416 critical splice donor site probably null
R7534:2310035C23Rik UTSW 1 105741023 missense probably benign 0.01
R7740:2310035C23Rik UTSW 1 105731261 missense probably damaging 1.00
R8036:2310035C23Rik UTSW 1 105678177 missense not run
Z1176:2310035C23Rik UTSW 1 105719615 missense not run
Predicted Primers PCR Primer
(F):5'- CACACTCTTGGCACATAAGC -3'
(R):5'- AAAGGTCACCGCTTCTCATTTTG -3'

Sequencing Primer
(F):5'- AGCCTACTTGCATGTCAGAG -3'
(R):5'- GTCTTGAACTCACAAAGATCTGCCTG -3'
Posted On2017-08-01