Incidental Mutation 'R5513:Prdm2'
ID484513
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5513 (G1)
Quality Score100
Status Validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) GCTCCTCCTCCTCCTCCTCCTCCTC to GCTCCTCCTCCTCCTCCTCCTC at 143135893 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably benign
Transcript: ENSMUST00000105778
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197026
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGAGCCTTCAGAAGTTTC -3'
(R):5'- AAGCGCTGTGTCTTCATCTC -3'

Sequencing Primer
(F):5'- CAGAAGTTTCAGTTGGCACACTC -3'
(R):5'- CTTCTGCTCCTTAGGTCCAAAAGAAG -3'
Posted On2017-08-01