Mutagenetix > Incidental Mutations

Incidental Mutation 'R5418:Irs1'

484514

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

042986-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.584) question?

Stock #

R5418 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 82288770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 575 (T575I)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069799
AA Change: T575I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: T575I

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.1878

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	C	6: 149,326,136	Y227H	probably damaging	Het
4930568D16Rik	A	G	2: 35,354,726	S205P	probably damaging	Het
9530077C05Rik	G	T	9: 22,431,770	R187L	probably damaging	Het
Abcc1	T	C	16: 14,461,132	V1102A	probably benign	Het
Acad8	A	T	9: 26,985,557	M202K	probably damaging	Het
Acoxl	T	A	2: 127,877,802	M161K	probably benign	Het
Adamts4	T	A	1: 171,252,574	V35E	probably damaging	Het
Add2	A	G	6: 86,110,912	S614G	probably benign	Het
Adgrv1	T	A	13: 81,419,308	I5249L	probably benign	Het
Agps	A	G	2: 75,858,904	T252A	probably damaging	Het
Alms1-ps1	G	A	6: 85,755,602		noncoding transcript	Het
Ankrd24	T	A	10: 81,644,942		probably benign	Het
Bcl9l	A	G	9: 44,505,436	Q218R	possibly damaging	Het
Bin2	T	C	15: 100,649,146	Y232C	probably damaging	Het
Bptf	A	G	11: 107,111,294	Y331H	probably damaging	Het
Ccr10	C	T	11: 101,174,078	V209M	probably benign	Het
Cflar	A	T	1: 58,752,651	D371V	possibly damaging	Het
Col1a2	A	G	6: 4,516,931		probably benign	Het
Crlf2	A	G	5: 109,557,033	V104A	probably benign	Het
Dennd1c	CCGCCCCTCGCTGACAGC	CC	17: 57,066,755		probably null	Het
Dmxl2	A	G	9: 54,374,651		probably null	Het
Dnah17	C	A	11: 118,094,984	E1422D	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Efcab11	A	G	12: 99,855,618	L80S	possibly damaging	Het
Emc8	G	A	8: 120,658,603	T130M	probably damaging	Het
Epha6	C	A	16: 60,424,835	A334S	possibly damaging	Het
Erc2	A	G	14: 27,966,510	M196V	probably benign	Het
Etnk2	T	C	1: 133,373,257	I254T	probably damaging	Het
Fam120b	C	T	17: 15,401,799	T13M	probably damaging	Het
Fam234b	A	G	6: 135,226,968	K423E	probably benign	Het
Fcgbp	G	A	7: 28,085,313	G266D	probably damaging	Het
Fndc4	A	T	5: 31,294,634	S146R	probably benign	Het
Frmd3	G	A	4: 74,161,698		probably null	Het
Glrx2	C	A	1: 143,739,708	S16R	possibly damaging	Het
Gm26526	T	G	7: 39,588,934		noncoding transcript	Het
Hc	C	T	2: 35,008,183		probably null	Het
Herc2	T	C	7: 56,137,565	C1695R	probably damaging	Het
Hic1	A	G	11: 75,166,599		probably null	Het
Igkv4-92	A	T	6: 68,755,580	V5E	possibly damaging	Het
Kcp	A	T	6: 29,504,284	Y143*	probably null	Het
Klb	A	G	5: 65,383,470	N969D	probably benign	Het
Klra6	T	A	6: 130,013,430	L239F	probably damaging	Het
Lhx6	A	G	2: 36,087,366		probably null	Het
Lrrc34	G	A	3: 30,642,774	P116S	possibly damaging	Het
Map3k9	T	A	12: 81,743,817	K321*	probably null	Het
Mapk14	T	C	17: 28,741,843	V196A	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Mtmr12	T	C	15: 12,269,959	L711P	probably damaging	Het
Mylk	T	C	16: 34,912,230	S627P	probably benign	Het
Nbea	A	T	3: 55,645,989	Y2631N	possibly damaging	Het
Ncoa7	A	G	10: 30,648,039	V153A	probably damaging	Het
Olfr1252	T	C	2: 89,721,999	I37M	probably benign	Het
Pax6	A	T	2: 105,691,565	D175V	probably benign	Het
Piezo1	A	G	8: 122,486,780	L1793P	probably damaging	Het
Pkp4	T	C	2: 59,310,162	V404A	probably benign	Het
Plxnb2	A	G	15: 89,166,491	Y421H	probably benign	Het
Prkdc	T	G	16: 15,795,097	V3173G	probably benign	Het
Prss40	A	T	1: 34,560,759	I49N	probably benign	Het
Prx	T	A	7: 27,517,274	V400E	probably damaging	Het
Rbm11	A	C	16: 75,596,535	T40P	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Sema3f	A	G	9: 107,692,621	Y70H	probably damaging	Het
Senp6	G	A	9: 80,121,869	E505K	possibly damaging	Het
Slc25a3	T	C	10: 91,119,536	I147M	probably benign	Het
Slc4a7	T	A	14: 14,760,280	S572T	probably benign	Het
Smarcal1	C	T	1: 72,598,909	P501S	probably benign	Het
Sox7	C	T	14: 63,947,947	T144M	probably benign	Het
Taar1	T	C	10: 23,921,316	F304S	possibly damaging	Het
Tcf3	A	G	10: 80,427,683	F46L	probably damaging	Het
Tmem184c	A	G	8: 77,597,820	V347A	probably damaging	Het
Tpcn2	C	T	7: 145,278,781	E113K	probably damaging	Het
Vmn1r232	T	A	17: 20,914,116	Y74F	possibly damaging	Het
Vmn2r102	C	T	17: 19,694,153	T660I	probably damaging	Het
Zdhhc3	A	G	9: 123,080,391	M234T	probably damaging	Het
Zfp960	T	A	17: 17,087,543	L173H	probably damaging	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- ATTGGGGTCCACTCTCTGTG -3'
(R):5'- TTTCGAAAGAGAACTCACTCCGC -3'

Sequencing Primer
(F):5'- CAGATACACTCTTGGGGCTCATG -3'
(R):5'- GCAGGCACATCTCCTACCATTTC -3'

Posted On

2017-08-08