Incidental Mutation 'R5435:Fbxo4'
ID484547
Institutional Source Beutler Lab
Gene Symbol Fbxo4
Ensembl Gene ENSMUSG00000022184
Gene NameF-box protein 4
Synonyms
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5435 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location3965445-3979573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3965792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 357 (V357I)
Ref Sequence ENSEMBL: ENSMUSP00000022791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022791
AA Change: V357I

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022791
Gene: ENSMUSG00000022184
AA Change: V357I

DomainStartEndE-ValueType
FBOX 60 100 5.57e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148817
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele exhibit increased tumor incidence of lymphoblastic lineage and premature death. Mice homozygous for a different knock-out allele are indistinguishable from wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Ddx19b T C 8: 111,008,826 Q416R possibly damaging Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Mpdz A G 4: 81,283,487 probably benign Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Olfr992 T A 2: 85,400,470 N21I probably benign Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Peak1 A G 9: 56,206,486 S694P probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Rbbp5 T A 1: 132,494,275 H304Q probably damaging Het
Scn1a T A 2: 66,273,534 E1783V probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Fbxo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Fbxo4 APN 15 3965755 nonsense probably null
IGL01879:Fbxo4 APN 15 3975954 missense probably damaging 0.99
IGL03070:Fbxo4 APN 15 3977862 missense possibly damaging 0.63
PIT1430001:Fbxo4 UTSW 15 3979300 missense probably benign 0.07
R1601:Fbxo4 UTSW 15 3968965 missense possibly damaging 0.77
R4556:Fbxo4 UTSW 15 3965705 makesense probably null
R4557:Fbxo4 UTSW 15 3965705 makesense probably null
R4783:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4784:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4785:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4871:Fbxo4 UTSW 15 3975912 missense probably damaging 1.00
R5023:Fbxo4 UTSW 15 3977756 splice site probably null
R5876:Fbxo4 UTSW 15 3977819 missense probably damaging 1.00
R6423:Fbxo4 UTSW 15 3965792 missense possibly damaging 0.73
R6481:Fbxo4 UTSW 15 3965734 missense probably damaging 1.00
R6656:Fbxo4 UTSW 15 3975823 missense probably damaging 0.99
R6999:Fbxo4 UTSW 15 3977955 missense probably damaging 1.00
R7505:Fbxo4 UTSW 15 3971421 missense probably benign 0.09
R7543:Fbxo4 UTSW 15 3977903 missense probably damaging 1.00
X0028:Fbxo4 UTSW 15 3971451 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAGTAGAAAGGCCTCCTC -3'
(R):5'- AACTTTATATGCCCCAGTACAAGG -3'

Sequencing Primer
(F):5'- GTAGAAAGGCCTCCTCCAGAG -3'
(R):5'- CCAGTACAAGGGAACGCCAG -3'
Posted On2017-08-11