Incidental Mutation 'R5592:Rb1'
ID484556
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
MMRRC Submission 043144-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5592 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73211747 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 648 (Y648H)
Ref Sequence ENSEMBL: ENSMUSP00000022701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000171767]
Predicted Effect probably damaging
Transcript: ENSMUST00000022701
AA Change: Y648H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: Y648H

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Predicted Effect probably benign
Transcript: ENSMUST00000171767
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Meta Mutation Damage Score 0.8491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,726,611 F2I probably damaging Het
Adam17 C T 12: 21,334,137 S454N probably damaging Het
Adcy1 A T 11: 7,139,088 K501* probably null Het
Arhgap28 A T 17: 67,858,272 M543K probably damaging Het
Art3 T A 5: 92,392,820 Y141N probably damaging Het
Ccdc38 C T 10: 93,550,202 T60I possibly damaging Het
Crmp1 A C 5: 37,265,265 I139L probably benign Het
Cul9 G A 17: 46,520,591 L1566F probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dpcr1 T C 17: 35,643,643 Y9C probably damaging Het
Drd1 A T 13: 54,054,171 M1K probably null Het
Flii T G 11: 60,720,399 M449L probably benign Het
Galnt16 T C 12: 80,588,519 V343A probably damaging Het
Gimap4 A T 6: 48,691,158 E154D probably damaging Het
Glmp T G 3: 88,326,026 probably benign Het
Glt1d1 A T 5: 127,657,119 D119V probably benign Het
Gm5930 C T 14: 44,331,429 M245I probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golgb1 T A 16: 36,925,763 H2901Q probably benign Het
Krt12 C T 11: 99,420,824 V184I probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mier3 T A 13: 111,706,661 Y182* probably null Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mmp25 A G 17: 23,640,202 V157A possibly damaging Het
Ms4a6c A G 19: 11,480,277 probably benign Het
Ms4a6c A G 19: 11,481,132 probably benign Het
Muc19 T C 15: 91,930,314 noncoding transcript Het
Mycbp2 C A 14: 103,194,677 M2308I probably benign Het
Myo1a G T 10: 127,714,039 V463F probably damaging Het
Ogdh A T 11: 6,316,763 probably null Het
Olfr1157 A G 2: 87,962,340 L184P probably damaging Het
Olfr651 A T 7: 104,553,731 N271Y probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paip1 C A 13: 119,450,798 D124E probably damaging Het
Pdcd11 T A 19: 47,102,725 N379K probably benign Het
Pitpnm2 T C 5: 124,142,149 E112G probably damaging Het
Prrg4 T C 2: 104,832,778 Y161C probably benign Het
Rpa3 A T 6: 8,257,694 M56K probably benign Het
Scarf1 A T 11: 75,525,687 T652S probably benign Het
Slc16a5 A G 11: 115,472,782 K423R probably benign Het
Sptan1 C T 2: 29,986,719 probably benign Het
Ssrp1 T C 2: 85,045,519 I574T probably benign Het
Synm A G 7: 67,759,516 L38P probably damaging Het
Ubqln4 T G 3: 88,556,864 M224R probably damaging Het
Uroc1 A G 6: 90,355,344 N561S probably damaging Het
Vav1 A G 17: 57,304,835 Y483C probably benign Het
Vps13a G A 19: 16,725,571 L673F probably damaging Het
Zfp418 G T 7: 7,181,315 K92N possibly damaging Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1752:Rb1 UTSW 14 73287624 missense probably damaging 0.99
R1919:Rb1 UTSW 14 73212990 nonsense probably null
R2010:Rb1 UTSW 14 73294993 missense probably benign 0.16
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4464:Rb1 UTSW 14 73199198 intron probably null
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R6326:Rb1 UTSW 14 73198534 missense probably benign 0.06
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6414:Rb1 UTSW 14 73282974 missense unknown
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7263:Rb1 UTSW 14 73282923 nonsense probably null
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
R7817:Rb1 UTSW 14 73198543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACAGTCAACTATGAGCAG -3'
(R):5'- TTCAGCAAGTATTACTGAGCCTTG -3'

Sequencing Primer
(F):5'- CAGTCAACTATGAGCAGGAAGAAAC -3'
(R):5'- CCTTGTGTATGGAATGCTGCTAATAC -3'
Posted On2017-08-11