Mutagenetix > Incidental Mutations

Incidental Mutation 'R5574:Plb1'

484565

Institutional Source

Beutler Lab

Gene Symbol

Plb1

Ensembl Gene

ENSMUSG00000029134

Gene Name

phospholipase B1

Synonyms

4930539A06Rik, 4632413E21Rik, 4930433E17Rik

MMRRC Submission

043129-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R5574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32232708-32366520 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32329947 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 929 (S929G)

Ref Sequence

ENSEMBL: ENSMUSP00000144040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]

Predicted Effect

probably benign
Transcript: ENSMUST00000101376
AA Change: S929G

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: S929G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202220
AA Change: S929G

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: S929G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202886

Meta Mutation Damage Score

0.2781

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,756	N31I	possibly damaging	Het
3110002H16Rik	CTGTGTGTT	CTGTGTGTTGTGTGTT	18: 12,185,006		probably null	Het
Acvr1b	T	A	15: 101,202,077	M304K	probably benign	Het
Adamts1	G	T	16: 85,799,642	D106E	probably damaging	Het
Blm	C	A	7: 80,499,773	C696F	probably damaging	Het
Bnip3l-ps	T	A	12: 18,217,118		noncoding transcript	Het
C87499	T	G	4: 88,628,043	E354A	probably benign	Het
Ccdc171	A	T	4: 83,693,753	N895I	probably damaging	Het
Cdhr4	A	T	9: 107,993,328		probably benign	Het
Cfap97	T	C	8: 46,170,142	S190P	probably damaging	Het
Chrnb1	A	C	11: 69,793,683		probably benign	Het
Clns1a	A	G	7: 97,720,958		probably benign	Het
Col8a2	G	A	4: 126,311,268		probably benign	Het
Cr2	T	A	1: 195,141,236	E721V	probably damaging	Het
Csk	A	G	9: 57,629,301	V172A	probably benign	Het
Cyp2g1	G	A	7: 26,820,740	V466M	possibly damaging	Het
Cyp4f13	A	G	17: 32,929,205	Y349H	probably benign	Het
Dnm1l	T	C	16: 16,329,821	Y205C	probably damaging	Het
Dync1i2	A	T	2: 71,233,650	T113S	probably benign	Het
Edem2	T	C	2: 155,716,155	E186G	probably damaging	Het
Eya2	G	A	2: 165,763,816	R380H	probably damaging	Het
Fam214a	A	T	9: 75,010,390	D757V	probably damaging	Het
Fam60a	C	T	6: 148,944,880		probably benign	Het
Gldn	A	G	9: 54,312,922	T132A	probably damaging	Het
Gm13941	A	T	2: 111,100,606	I74K	unknown	Het
Gm3898	C	T	9: 43,830,042		noncoding transcript	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Klhdc10	C	T	6: 30,439,865	L127F	possibly damaging	Het
Letm1	G	A	5: 33,769,386	T189M	possibly damaging	Het
Lrrc17	A	T	5: 21,570,357	I306F	possibly damaging	Het
Lrrk2	T	A	15: 91,787,016	V2000E	probably damaging	Het
Mettl9	A	T	7: 121,047,870	E66D	probably benign	Het
Mroh1	T	A	15: 76,433,931	V877D	probably benign	Het
Mycbp2	C	T	14: 103,142,767	V3760M	possibly damaging	Het
Nos3	A	G	5: 24,368,861	T208A	possibly damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Obp2a	A	T	2: 25,700,830	T70S	possibly damaging	Het
Olfr1040	T	C	2: 86,146,191	D181G	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr1245	C	T	2: 89,574,977	V250I	possibly damaging	Het
Olfr145	A	T	9: 37,897,581	Y59F	probably damaging	Het
Olfr69	T	G	7: 103,768,116	I94L	possibly damaging	Het
Pate2	A	G	9: 35,686,115		probably benign	Het
Pdzph1	A	G	17: 58,973,947	F447L	probably benign	Het
Pias1	A	G	9: 62,920,493	C211R	probably damaging	Het
Prc1	G	A	7: 80,294,542		probably benign	Het
Prex2	A	G	1: 11,140,058	D574G	probably damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rock2	T	C	12: 16,961,641	M690T	possibly damaging	Het
Slc18a2	A	G	19: 59,261,405	I25V	probably benign	Het
Slc9a5	T	A	8: 105,364,691	I701K	probably benign	Het
Sorcs1	T	A	19: 50,222,133	N765Y	probably damaging	Het
Ssh2	A	T	11: 77,450,115	I698L	probably benign	Het
Stam	A	G	2: 14,115,864	D58G	probably damaging	Het
Thsd4	C	A	9: 59,972,400	R1018L	probably damaging	Het
Tnxb	A	G	17: 34,711,024	T2911A	probably benign	Het
Trpm7	A	C	2: 126,813,030	F1329L	probably benign	Het
Ttll9	A	G	2: 152,984,248	E126G	possibly damaging	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Unc45a	G	A	7: 80,334,856	A232V	probably damaging	Het
Utp14b	G	A	1: 78,666,409	V675M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,891	H279L	probably benign	Het
Vmn2r75	G	T	7: 86,166,302	A118E	probably benign	Het
Wdr36	A	T	18: 32,865,959	Q886L	probably damaging	Het
Zfp433	T	A	10: 81,719,291	Y27*	probably null	Het
Zfp715	A	T	7: 43,311,039	S43T	possibly damaging	Het
Zfyve26	A	G	12: 79,239,924	S2297P	possibly damaging	Het

Other mutations in Plb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Plb1	APN	5	32345736	missense	probably benign	0.00
IGL00542:Plb1	APN	5	32269834	missense	probably benign	0.02
IGL00835:Plb1	APN	5	32364172	missense	unknown
IGL00954:Plb1	APN	5	32298514	splice site	probably benign
IGL01350:Plb1	APN	5	32317064	missense	probably damaging	1.00
IGL01527:Plb1	APN	5	32317123	missense	probably damaging	1.00
IGL01599:Plb1	APN	5	32342544	splice site	probably benign
IGL01690:Plb1	APN	5	32313697	missense	probably damaging	1.00
IGL01813:Plb1	APN	5	32329085	missense	probably damaging	1.00
IGL01826:Plb1	APN	5	32281145	missense	probably damaging	0.99
IGL02263:Plb1	APN	5	32321348	splice site	probably benign
IGL02314:Plb1	APN	5	32281148	missense	possibly damaging	0.93
IGL02649:Plb1	APN	5	32362568	missense	probably benign	0.09
IGL02701:Plb1	APN	5	32364197	missense	unknown
IGL02704:Plb1	APN	5	32353667	missense	probably benign	0.03
IGL03170:Plb1	APN	5	32284902	missense	probably damaging	0.99
IGL03182:Plb1	APN	5	32344915	splice site	probably benign
IGL03326:Plb1	APN	5	32331327	missense	probably benign	0.00
IGL03046:Plb1	UTSW	5	32328412	missense	probably damaging	1.00
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0330:Plb1	UTSW	5	32355357	missense	probably damaging	1.00
R0413:Plb1	UTSW	5	32355362	missense	probably damaging	1.00
R0721:Plb1	UTSW	5	32364195	missense	unknown
R0735:Plb1	UTSW	5	32284920	missense	possibly damaging	0.90
R1423:Plb1	UTSW	5	32293257	missense	probably benign
R1428:Plb1	UTSW	5	32264912	missense	possibly damaging	0.82
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1694:Plb1	UTSW	5	32317277	missense	probably null	0.01
R1801:Plb1	UTSW	5	32293243	missense	probably damaging	1.00
R1804:Plb1	UTSW	5	32353697	missense	possibly damaging	0.91
R1900:Plb1	UTSW	5	32286847	missense	probably benign	0.44
R1903:Plb1	UTSW	5	32291238	missense	probably damaging	1.00
R2101:Plb1	UTSW	5	32349660	missense	probably damaging	1.00
R2153:Plb1	UTSW	5	32314089	missense	probably damaging	1.00
R2207:Plb1	UTSW	5	32316640	missense	possibly damaging	0.50
R2270:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2271:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2311:Plb1	UTSW	5	32269818	missense	probably benign	0.01
R2850:Plb1	UTSW	5	32293224	missense	probably benign
R3103:Plb1	UTSW	5	32328029	missense	possibly damaging	0.92
R4444:Plb1	UTSW	5	32330565	missense	probably benign	0.06
R4559:Plb1	UTSW	5	32332831	missense	probably damaging	0.99
R4577:Plb1	UTSW	5	32247557	nonsense	probably null
R4578:Plb1	UTSW	5	32247557	nonsense	probably null
R4739:Plb1	UTSW	5	32349679	splice site	probably null
R4747:Plb1	UTSW	5	32349659	missense	probably benign	0.08
R4806:Plb1	UTSW	5	32289852	missense	probably damaging	1.00
R5406:Plb1	UTSW	5	32341915	missense	probably damaging	1.00
R5567:Plb1	UTSW	5	32364199	missense	unknown
R5588:Plb1	UTSW	5	32329949	critical splice donor site	probably null
R5619:Plb1	UTSW	5	32333497	missense	probably damaging	0.99
R5769:Plb1	UTSW	5	32317522	missense	probably benign	0.05
R6366:Plb1	UTSW	5	32314085	missense	possibly damaging	0.59
R6700:Plb1	UTSW	5	32333464	missense	probably damaging	0.99
R7162:Plb1	UTSW	5	32349663	missense	probably benign	0.30
R7379:Plb1	UTSW	5	32345639	missense	probably damaging	1.00
R7395:Plb1	UTSW	5	32353684	missense	probably benign	0.30
R7426:Plb1	UTSW	5	32321247	splice site	probably null
R7643:Plb1	UTSW	5	32247557	nonsense	probably null
R7657:Plb1	UTSW	5	32329867	missense	probably damaging	0.98
R7780:Plb1	UTSW	5	32326266	splice site	probably null
R8040:Plb1	UTSW	5	32273069	missense	possibly damaging	0.89
R8212:Plb1	UTSW	5	32264906	missense	probably damaging	1.00
R8312:Plb1	UTSW	5	32328485	missense	probably damaging	1.00
R8560:Plb1	UTSW	5	32302679	missense	possibly damaging	0.95
R8770:Plb1	UTSW	5	32247509	missense	unknown
X0018:Plb1	UTSW	5	32285883	missense	probably benign	0.01
X0019:Plb1	UTSW	5	32353697	missense	probably damaging	0.99
X0027:Plb1	UTSW	5	32270358	missense	probably benign
X0028:Plb1	UTSW	5	32302675	missense	probably damaging	1.00
Z1088:Plb1	UTSW	5	32310847	missense	probably damaging	0.99
Z1088:Plb1	UTSW	5	32310917	missense	probably benign
Z1177:Plb1	UTSW	5	32284897	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GTGGATGGACCTGTCTCTTGAAC -3'
(R):5'- TCAGTCTCTCCAACAGTAGCC -3'

Sequencing Primer
(F):5'- ACCTGTCTCTTGAACTTAAGGG -3'
(R):5'- CCCGGTGGTCTTGCTAGCATAG -3'

Posted On

2017-08-14