Incidental Mutation 'R5574:Klhdc10'
ID 484566
Institutional Source Beutler Lab
Gene Symbol Klhdc10
Ensembl Gene ENSMUSG00000029775
Gene Name kelch domain containing 10
Synonyms
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 30401868-30455179 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30439865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 127 (L127F)
Ref Sequence ENSEMBL: ENSMUSP00000064594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068240] [ENSMUST00000068259] [ENSMUST00000123494] [ENSMUST00000132581] [ENSMUST00000135566] [ENSMUST00000144272]
AlphaFold Q6PAR0
Predicted Effect possibly damaging
Transcript: ENSMUST00000068240
AA Change: L127F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064594
Gene: ENSMUSG00000029775
AA Change: L127F

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 56 107 3.6e-7 PFAM
Pfam:Kelch_1 59 114 5.6e-8 PFAM
Pfam:Kelch_4 59 120 1.8e-7 PFAM
Pfam:Kelch_6 59 120 2.1e-8 PFAM
Pfam:Kelch_4 173 222 9.8e-9 PFAM
Pfam:Kelch_6 173 225 3.9e-9 PFAM
Pfam:Kelch_2 174 218 1.2e-7 PFAM
Pfam:Kelch_1 174 219 9.4e-8 PFAM
Kelch 239 294 4.93e0 SMART
Kelch 295 342 9.96e-4 SMART
low complexity region 373 384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068259
AA Change: L156F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069669
Gene: ENSMUSG00000029775
AA Change: L156F

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 85 135 1.2e-7 PFAM
Pfam:Kelch_1 88 143 2.6e-8 PFAM
Pfam:Kelch_4 88 149 1.5e-6 PFAM
Pfam:Kelch_6 88 150 3.1e-8 PFAM
Pfam:Kelch_6 202 255 4.6e-9 PFAM
Pfam:Kelch_2 203 247 1.4e-7 PFAM
Pfam:Kelch_1 203 248 2.6e-6 PFAM
Kelch 268 323 4.93e0 SMART
Kelch 324 371 9.96e-4 SMART
low complexity region 402 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123494
AA Change: L16F

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145442
Gene: ENSMUSG00000029775
AA Change: L16F

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 1.2e-4 PFAM
Pfam:Kelch_6 62 115 5.2e-8 PFAM
Pfam:Kelch_2 63 107 1.6e-6 PFAM
Pfam:Kelch_1 63 108 3.1e-5 PFAM
Pfam:Kelch_1 116 157 2.1e-6 PFAM
Pfam:Kelch_6 116 157 8.8e-6 PFAM
Pfam:Kelch_4 122 157 3.7e-4 PFAM
Predicted Effect silent
Transcript: ENSMUST00000132581
SMART Domains Protein: ENSMUSP00000143839
Gene: ENSMUSG00000029775

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
Pfam:Kelch_2 121 165 1.1e-6 PFAM
Pfam:Kelch_6 121 173 2.4e-8 PFAM
Pfam:Kelch_1 123 166 2.1e-5 PFAM
Pfam:Kelch_4 123 168 9.8e-5 PFAM
Kelch 186 241 1.7e-2 SMART
Kelch 242 289 3.3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135566
AA Change: L16F

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144878
Gene: ENSMUSG00000029775
AA Change: L16F

DomainStartEndE-ValueType
Blast:Kelch 1 21 4e-6 BLAST
SCOP:d1k3ia3 7 51 1e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144272
AA Change: L16F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145063
Gene: ENSMUSG00000029775
AA Change: L16F

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 3.5e-4 PFAM
Pfam:Kelch_6 62 115 1.6e-7 PFAM
Pfam:Kelch_2 63 107 4.8e-6 PFAM
Pfam:Kelch_1 63 108 9.1e-5 PFAM
Kelch 128 183 1.7e-2 SMART
Kelch 184 231 3.3e-6 SMART
low complexity region 262 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150854
Meta Mutation Damage Score 0.0934 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Klhdc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Klhdc10 APN 6 30441934 splice site probably null
IGL02313:Klhdc10 APN 6 30439866 critical splice donor site probably null
IGL03353:Klhdc10 APN 6 30447992 splice site probably benign
PIT4378001:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R0379:Klhdc10 UTSW 6 30450670 missense possibly damaging 0.89
R0390:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R1199:Klhdc10 UTSW 6 30449494 missense probably damaging 1.00
R1628:Klhdc10 UTSW 6 30444462 missense probably damaging 0.98
R2243:Klhdc10 UTSW 6 30449559 missense probably damaging 1.00
R2861:Klhdc10 UTSW 6 30402140 missense unknown
R5007:Klhdc10 UTSW 6 30450641 missense probably benign 0.05
R6428:Klhdc10 UTSW 6 30439856 missense probably damaging 1.00
R6724:Klhdc10 UTSW 6 30446641 missense probably damaging 0.99
R6842:Klhdc10 UTSW 6 30439782 missense probably damaging 1.00
R6879:Klhdc10 UTSW 6 30449590 missense probably damaging 1.00
R7014:Klhdc10 UTSW 6 30450503 missense probably damaging 1.00
R7124:Klhdc10 UTSW 6 30441827 missense probably damaging 1.00
R7453:Klhdc10 UTSW 6 30447990 critical splice donor site probably null
R7988:Klhdc10 UTSW 6 30446691 missense probably benign
R9192:Klhdc10 UTSW 6 30449500 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTTAGGCCACAGACCTCC -3'
(R):5'- GCAGCGATTCAGAGTCATTACAC -3'

Sequencing Primer
(F):5'- CGTTGTGTGGCAGACAATACCAATC -3'
(R):5'- CATTACACTGTATTATCACCACAGTG -3'
Posted On 2017-08-14