Incidental Mutation 'R5557:Tead3'
ID484570
Institutional Source Beutler Lab
Gene Symbol Tead3
Ensembl Gene ENSMUSG00000002249
Gene NameTEA domain family member 3
SynonymsDTEF-1, TEF-5, Tcf13r2, ETFR-1, TEAD-3
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5557 (G1)
Quality Score51
Status Validated
Chromosome17
Chromosomal Location28331671-28350805 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 28336270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114799] [ENSMUST00000154873] [ENSMUST00000156862] [ENSMUST00000219703]
Predicted Effect probably benign
Transcript: ENSMUST00000114799
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151557
Predicted Effect probably benign
Transcript: ENSMUST00000154873
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156862
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226172
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and thought to play a role in placental gene regulation and development. Alternative splicing, and alternate use of an upstream AUG translation initiation codon, and an in-frame downstream non-AUG (AUA) codon, results in 2 isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Tead3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Tead3 APN 17 28332806 missense possibly damaging 0.91
IGL01752:Tead3 APN 17 28333594 missense probably damaging 1.00
IGL01760:Tead3 APN 17 28333081 missense probably benign 0.07
IGL02868:Tead3 APN 17 28333095 nonsense probably null
IGL02932:Tead3 APN 17 28341351 missense probably damaging 1.00
R0015:Tead3 UTSW 17 28341351 missense probably damaging 1.00
R0376:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R0383:Tead3 UTSW 17 28334698 splice site probably null
R1203:Tead3 UTSW 17 28341562 missense probably benign 0.06
R1699:Tead3 UTSW 17 28334724 missense possibly damaging 0.52
R2037:Tead3 UTSW 17 28336570 missense probably damaging 0.98
R2148:Tead3 UTSW 17 28333664 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28333615 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28334988 missense probably benign 0.42
R5070:Tead3 UTSW 17 28341477 missense probably benign 0.06
R5891:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R5991:Tead3 UTSW 17 28334378 splice site probably null
R6335:Tead3 UTSW 17 28333325 missense probably damaging 1.00
R6999:Tead3 UTSW 17 28341532 missense probably benign 0.00
R7165:Tead3 UTSW 17 28333254 missense probably benign 0.00
R7718:Tead3 UTSW 17 28333517 missense probably damaging 1.00
R7743:Tead3 UTSW 17 28332827 missense probably benign 0.06
R8025:Tead3 UTSW 17 28335035 missense probably benign 0.23
R8034:Tead3 UTSW 17 28333229 missense probably damaging 1.00
X0066:Tead3 UTSW 17 28341427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTGAAGACTACTTTTGGG -3'
(R):5'- ACCAGGTTGGCATTAAGGTACG -3'

Sequencing Primer
(F):5'- GTCCTGGAACTCAGATCTGACTG -3'
(R):5'- ACGTTGGGTGCCTAGCAG -3'
Posted On2017-08-14