Mutagenetix > Incidental Mutation

Incidental Mutation 'R5434:Col9a2'

484572

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

042999-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 121040965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 25 (R25*)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000030372
AA Change: R25*

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R25*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151987

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	C	3: 36,875,516	D94A	probably damaging	Het
Angptl6	G	T	9: 20,875,525	Q301K	probably damaging	Het
Ankfn1	T	C	11: 89,453,187	Y323C	probably damaging	Het
Arid5b	T	A	10: 68,096,889	H818L	possibly damaging	Het
Armc4	T	C	18: 7,222,550	K573R	probably benign	Het
Atg13	G	T	2: 91,684,765		probably null	Het
Bop1	T	C	15: 76,455,411	M245V	probably benign	Het
Ccdc105	A	T	10: 78,748,650	L346*	probably null	Het
Ces2a	T	A	8: 104,737,409	F224L	probably damaging	Het
Cntnap5b	A	G	1: 100,072,201	H228R	probably benign	Het
Dcaf12	G	T	4: 41,302,744	T137N	probably benign	Het
Dennd4c	A	G	4: 86,811,456	N765S	probably benign	Het
Dnah12	A	G	14: 26,859,299	Y3162C	probably damaging	Het
Dpf1	G	T	7: 29,311,331	C123F	possibly damaging	Het
Flvcr1	C	A	1: 191,026,009	A29S	probably benign	Het
Frmd3	A	T	4: 74,187,796	I560F	probably damaging	Het
Galnt15	G	A	14: 32,049,843	V282I	possibly damaging	Het
Gm14412	A	T	2: 177,314,612	C497S	probably damaging	Het
Gm20830	A	T	Y: 6,916,464	Y218*	probably null	Het
Hmcn2	C	A	2: 31,420,363	T3323N	probably damaging	Het
Idh1	T	A	1: 65,175,336	Q6L	probably benign	Het
Kansl2-ps	A	G	7: 72,673,065		noncoding transcript	Het
Kcnj10	T	A	1: 172,369,480	V187E	probably damaging	Het
Khnyn	A	G	14: 55,887,500	T404A	probably damaging	Het
Lrp1b	T	A	2: 41,770,868	N76I	probably damaging	Het
Lrrc9	G	A	12: 72,454,088	C196Y	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mgp	T	A	6: 136,872,774	N62I	probably benign	Het
Ms4a6c	T	A	19: 11,471,224	H40Q	probably benign	Het
Necab3	A	G	2: 154,547,459	S121P	probably damaging	Het
Nfkb1	T	A	3: 135,626,611	K128*	probably null	Het
Nr4a3	A	T	4: 48,067,861	R486W	probably damaging	Het
Nwd2	A	G	5: 63,807,648	K1525R	probably benign	Het
Pbrm1	G	T	14: 31,085,011	D1085Y	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rbm15	A	G	3: 107,330,467	S872P	possibly damaging	Het
Retsat	A	G	6: 72,601,535	I77V	probably damaging	Het
Rpl32	A	G	6: 115,807,035	F77L	probably benign	Het
Ryr3	A	T	2: 112,794,469	V2202D	probably damaging	Het
Sars2	G	A	7: 28,750,291	R387Q	probably null	Het
Serpinb3d	G	T	1: 107,078,533	T275N	probably benign	Het
Sf3a1	C	A	11: 4,174,041	P296Q	probably damaging	Het
Sh3bgr	A	G	16: 96,224,544		probably benign	Het
St3gal3	A	G	4: 117,940,050	L332P	probably damaging	Het
Ston1	A	G	17: 88,645,311		probably benign	Het
Syne2	T	A	12: 75,971,875	S3383T	probably damaging	Het
Tnfsf14	A	G	17: 57,192,592	S87P	probably benign	Het
Trap1	T	C	16: 4,044,665	D583G	probably benign	Het
Ube2cbp	A	T	9: 86,427,407	I212N	possibly damaging	Het
Usp34	T	A	11: 23,412,271	D1572E	probably damaging	Het
Vmn1r179	A	T	7: 23,928,962	T193S	probably benign	Het
Vmn2r111	C	A	17: 22,548,489	V676L	probably damaging	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Wls	C	T	3: 159,934,340	R536C	probably damaging	Het
Zfhx3	A	G	8: 108,792,399	D51G	probably damaging	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTGCAAAGACCGTGTGAC -3'
(R):5'- GCGCTAAACTTCCAGGCATC -3'

Sequencing Primer
(F):5'- CAACCTAGGGTGTAATCACGGTTTC -3'
(R):5'- AGGCATCCCCACCCCTG -3'

Posted On

2017-08-14