Incidental Mutation 'R6087:Hjurp'
ID 484590
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
MMRRC Submission 044244-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R6087 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) GT to GTT at 88194246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 88,119,621 (GRCm39) K126R possibly damaging Het
Adam7 A T 14: 68,748,206 (GRCm39) C548S probably damaging Het
Adar C A 3: 89,652,897 (GRCm39) H260N probably benign Het
Ak9 A G 10: 41,258,828 (GRCm39) E775G probably benign Het
Arhgap35 T C 7: 16,297,568 (GRCm39) Y499C probably damaging Het
Bank1 A G 3: 135,772,190 (GRCm39) L480P probably damaging Het
Cep135 G T 5: 76,763,638 (GRCm39) probably null Het
Cnga1 G T 5: 72,768,155 (GRCm39) A177E probably damaging Het
Cubn T A 2: 13,432,658 (GRCm39) D1221V probably damaging Het
Cyp2d40 T C 15: 82,648,205 (GRCm39) Y36C possibly damaging Het
Dock8 C A 19: 25,138,438 (GRCm39) N1254K probably benign Het
Elapor2 T C 5: 9,449,255 (GRCm39) S128P probably damaging Het
Fam13b C T 18: 34,620,192 (GRCm39) V231I possibly damaging Het
Fbxo8 T A 8: 57,022,353 (GRCm39) Y122N probably damaging Het
Fmo2 T A 1: 162,708,002 (GRCm39) I378F probably benign Het
Golga3 A T 5: 110,352,812 (GRCm39) Q861L probably damaging Het
Ighv3-8 G T 12: 114,286,000 (GRCm39) A114E probably damaging Het
Itga3 C T 11: 94,943,269 (GRCm39) probably null Het
Kank1 G A 19: 25,387,088 (GRCm39) V254I probably benign Het
Lipo5 A T 19: 33,443,375 (GRCm39) I147K unknown Het
Lrfn2 A G 17: 49,378,154 (GRCm39) S412G probably benign Het
Lrrn3 T C 12: 41,503,534 (GRCm39) N261S possibly damaging Het
Mical2 C T 7: 111,917,692 (GRCm39) Q350* probably null Het
Nras T C 3: 102,967,637 (GRCm39) F78L probably damaging Het
Nudt9 A G 5: 104,198,679 (GRCm39) I65V probably benign Het
Or10ag59 A G 2: 87,406,259 (GRCm39) D277G probably benign Het
Or4f17-ps1 A T 2: 111,358,526 (GRCm39) E289V possibly damaging Het
Oscar G A 7: 3,614,311 (GRCm39) P143S probably benign Het
Pla2g4d C T 2: 120,100,487 (GRCm39) G615D probably damaging Het
Plekha1 T G 7: 130,502,301 (GRCm39) S175A probably benign Het
Psg27 T C 7: 18,290,869 (GRCm39) K445E probably benign Het
Rad51c A G 11: 87,271,705 (GRCm39) Y318H probably benign Het
Ret G T 6: 118,153,252 (GRCm39) T472K possibly damaging Het
Tarbp1 T C 8: 127,155,709 (GRCm39) D1343G probably benign Het
Top2b C A 14: 16,409,864 (GRCm38) R844S probably benign Het
Vmn1r171 T A 7: 23,332,429 (GRCm39) M218K probably damaging Het
Vmn2r89 A T 14: 51,695,033 (GRCm39) probably null Het
Zc3h13 T A 14: 75,568,149 (GRCm39) D1147E probably damaging Het
Zgrf1 T A 3: 127,409,135 (GRCm39) L1703H probably damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1992:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2002:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2871:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6175:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9475:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- AACTGTCATGGTTTGTGATGCCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On 2017-08-16