Incidental Mutation 'R6087:Nudt9'
ID484604
Institutional Source Beutler Lab
Gene Symbol Nudt9
Ensembl Gene ENSMUSG00000029310
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 9
Synonyms1190002C07Rik
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104046306-104065379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104050813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 65 (I65V)
Ref Sequence ENSEMBL: ENSMUSP00000114631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031250] [ENSMUST00000128511] [ENSMUST00000134313] [ENSMUST00000148261] [ENSMUST00000150226]
Predicted Effect probably benign
Transcript: ENSMUST00000031250
AA Change: I115V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031250
Gene: ENSMUSG00000029310
AA Change: I115V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Pfam:NUDIX 189 334 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128511
AA Change: I65V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119820
Gene: ENSMUSG00000029310
AA Change: I65V

DomainStartEndE-ValueType
PDB:1QVJ|A 9 158 1e-89 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134313
AA Change: I65V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117181
Gene: ENSMUSG00000029310
AA Change: I65V

DomainStartEndE-ValueType
PDB:1QVJ|A 9 152 2e-84 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142018
Predicted Effect probably benign
Transcript: ENSMUST00000148261
AA Change: I65V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115170
Gene: ENSMUSG00000029310
AA Change: I65V

DomainStartEndE-ValueType
PDB:1QVJ|A 9 110 2e-68 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150226
AA Change: I65V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114631
Gene: ENSMUSG00000029310
AA Change: I65V

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
Pfam:NUDIX 131 207 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196765
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Nudt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Nudt9 APN 5 104061762 unclassified probably benign
IGL01398:Nudt9 APN 5 104065113 makesense probably null
IGL01910:Nudt9 APN 5 104054309 missense probably damaging 0.96
IGL02441:Nudt9 APN 5 104065019 missense probably benign 0.01
IGL03207:Nudt9 APN 5 104058226 splice site probably benign
steady UTSW 5 104058111 missense probably damaging 1.00
streak UTSW 5 104050621 start codon destroyed possibly damaging 0.89
struck UTSW 5 104065038 nonsense probably null
R0136:Nudt9 UTSW 5 104047106 missense probably benign
R0227:Nudt9 UTSW 5 104061675 missense possibly damaging 0.90
R0652:Nudt9 UTSW 5 104050601 missense possibly damaging 0.48
R0755:Nudt9 UTSW 5 104065054 missense probably damaging 0.98
R1156:Nudt9 UTSW 5 104050730 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1962:Nudt9 UTSW 5 104065105 missense probably benign
R2697:Nudt9 UTSW 5 104064993 missense probably damaging 1.00
R2916:Nudt9 UTSW 5 104055558 missense probably damaging 1.00
R3780:Nudt9 UTSW 5 104047106 missense probably benign
R3972:Nudt9 UTSW 5 104047125 missense probably benign 0.00
R4354:Nudt9 UTSW 5 104058111 missense probably damaging 1.00
R5325:Nudt9 UTSW 5 104050621 start codon destroyed possibly damaging 0.89
R5652:Nudt9 UTSW 5 104059780 missense probably benign 0.19
R6240:Nudt9 UTSW 5 104047089 missense probably benign 0.31
R6241:Nudt9 UTSW 5 104054285 missense probably damaging 0.98
R6280:Nudt9 UTSW 5 104065069 missense probably benign
R6719:Nudt9 UTSW 5 104061696 missense probably damaging 1.00
R6865:Nudt9 UTSW 5 104059679 missense probably damaging 1.00
R7225:Nudt9 UTSW 5 104065100 missense probably benign
R7629:Nudt9 UTSW 5 104050694 missense possibly damaging 0.90
X0063:Nudt9 UTSW 5 104050694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCTAATGGTGCCAAAGAG -3'
(R):5'- AAACAGCGGCGATTCCAAATAG -3'

Sequencing Primer
(F):5'- TGGTGCCAAAGAGAATTCCC -3'
(R):5'- GGCGATTCCAAATAGATTTGCCC -3'
Posted On2017-08-16