Incidental Mutation 'R6087:Golga3'
ID 484605
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgin A3
Synonyms G1-499-14, repro27, Mea-2, Mea2, 5430416E01Rik
MMRRC Submission 044244-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110324723-110374336 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110352812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 861 (Q861L)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031477
AA Change: Q901L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: Q901L

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112512
AA Change: Q861L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: Q861L

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 88,119,621 (GRCm39) K126R possibly damaging Het
Adam7 A T 14: 68,748,206 (GRCm39) C548S probably damaging Het
Adar C A 3: 89,652,897 (GRCm39) H260N probably benign Het
Ak9 A G 10: 41,258,828 (GRCm39) E775G probably benign Het
Arhgap35 T C 7: 16,297,568 (GRCm39) Y499C probably damaging Het
Bank1 A G 3: 135,772,190 (GRCm39) L480P probably damaging Het
Cep135 G T 5: 76,763,638 (GRCm39) probably null Het
Cnga1 G T 5: 72,768,155 (GRCm39) A177E probably damaging Het
Cubn T A 2: 13,432,658 (GRCm39) D1221V probably damaging Het
Cyp2d40 T C 15: 82,648,205 (GRCm39) Y36C possibly damaging Het
Dock8 C A 19: 25,138,438 (GRCm39) N1254K probably benign Het
Elapor2 T C 5: 9,449,255 (GRCm39) S128P probably damaging Het
Fam13b C T 18: 34,620,192 (GRCm39) V231I possibly damaging Het
Fbxo8 T A 8: 57,022,353 (GRCm39) Y122N probably damaging Het
Fmo2 T A 1: 162,708,002 (GRCm39) I378F probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ighv3-8 G T 12: 114,286,000 (GRCm39) A114E probably damaging Het
Itga3 C T 11: 94,943,269 (GRCm39) probably null Het
Kank1 G A 19: 25,387,088 (GRCm39) V254I probably benign Het
Lipo5 A T 19: 33,443,375 (GRCm39) I147K unknown Het
Lrfn2 A G 17: 49,378,154 (GRCm39) S412G probably benign Het
Lrrn3 T C 12: 41,503,534 (GRCm39) N261S possibly damaging Het
Mical2 C T 7: 111,917,692 (GRCm39) Q350* probably null Het
Nras T C 3: 102,967,637 (GRCm39) F78L probably damaging Het
Nudt9 A G 5: 104,198,679 (GRCm39) I65V probably benign Het
Or10ag59 A G 2: 87,406,259 (GRCm39) D277G probably benign Het
Or4f17-ps1 A T 2: 111,358,526 (GRCm39) E289V possibly damaging Het
Oscar G A 7: 3,614,311 (GRCm39) P143S probably benign Het
Pla2g4d C T 2: 120,100,487 (GRCm39) G615D probably damaging Het
Plekha1 T G 7: 130,502,301 (GRCm39) S175A probably benign Het
Psg27 T C 7: 18,290,869 (GRCm39) K445E probably benign Het
Rad51c A G 11: 87,271,705 (GRCm39) Y318H probably benign Het
Ret G T 6: 118,153,252 (GRCm39) T472K possibly damaging Het
Tarbp1 T C 8: 127,155,709 (GRCm39) D1343G probably benign Het
Top2b C A 14: 16,409,864 (GRCm38) R844S probably benign Het
Vmn1r171 T A 7: 23,332,429 (GRCm39) M218K probably damaging Het
Vmn2r89 A T 14: 51,695,033 (GRCm39) probably null Het
Zc3h13 T A 14: 75,568,149 (GRCm39) D1147E probably damaging Het
Zgrf1 T A 3: 127,409,135 (GRCm39) L1703H probably damaging Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110,368,753 (GRCm39) missense probably damaging 1.00
IGL00594:Golga3 APN 5 110,352,841 (GRCm39) missense probably benign 0.37
IGL00672:Golga3 APN 5 110,360,110 (GRCm39) missense probably damaging 1.00
IGL00821:Golga3 APN 5 110,352,799 (GRCm39) missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110,335,583 (GRCm39) missense probably benign 0.04
IGL01408:Golga3 APN 5 110,365,675 (GRCm39) critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110,340,771 (GRCm39) critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110,336,612 (GRCm39) missense probably benign 0.26
cles UTSW 5 110,336,573 (GRCm39) nonsense probably null
tenta UTSW 5 110,365,996 (GRCm39) nonsense probably null
PIT4544001:Golga3 UTSW 5 110,336,556 (GRCm39) missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110,350,643 (GRCm39) missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110,350,643 (GRCm39) missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110,336,609 (GRCm39) missense probably damaging 1.00
R1219:Golga3 UTSW 5 110,332,215 (GRCm39) nonsense probably null
R1297:Golga3 UTSW 5 110,352,709 (GRCm39) missense probably benign 0.04
R1299:Golga3 UTSW 5 110,352,709 (GRCm39) missense probably benign 0.04
R1465:Golga3 UTSW 5 110,357,744 (GRCm39) missense probably damaging 1.00
R1465:Golga3 UTSW 5 110,357,744 (GRCm39) missense probably damaging 1.00
R1589:Golga3 UTSW 5 110,329,649 (GRCm39) missense probably damaging 1.00
R1795:Golga3 UTSW 5 110,355,493 (GRCm39) missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110,340,839 (GRCm39) missense probably damaging 0.96
R2116:Golga3 UTSW 5 110,335,261 (GRCm39) missense probably damaging 0.97
R2130:Golga3 UTSW 5 110,350,805 (GRCm39) critical splice donor site probably null
R2153:Golga3 UTSW 5 110,335,856 (GRCm39) splice site probably null
R2158:Golga3 UTSW 5 110,335,227 (GRCm39) missense probably damaging 1.00
R2357:Golga3 UTSW 5 110,350,514 (GRCm39) missense probably damaging 1.00
R2397:Golga3 UTSW 5 110,353,743 (GRCm39) splice site probably benign
R2418:Golga3 UTSW 5 110,349,734 (GRCm39) missense probably damaging 1.00
R2495:Golga3 UTSW 5 110,355,462 (GRCm39) missense probably damaging 0.99
R2763:Golga3 UTSW 5 110,352,761 (GRCm39) missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110,349,864 (GRCm39) splice site probably benign
R3614:Golga3 UTSW 5 110,368,774 (GRCm39) missense probably damaging 1.00
R4520:Golga3 UTSW 5 110,351,617 (GRCm39) nonsense probably null
R5001:Golga3 UTSW 5 110,353,643 (GRCm39) missense probably damaging 1.00
R5046:Golga3 UTSW 5 110,340,806 (GRCm39) missense probably damaging 0.99
R5157:Golga3 UTSW 5 110,350,537 (GRCm39) missense probably benign 0.00
R5191:Golga3 UTSW 5 110,332,173 (GRCm39) intron probably benign
R5376:Golga3 UTSW 5 110,368,811 (GRCm39) critical splice donor site probably null
R5399:Golga3 UTSW 5 110,352,890 (GRCm39) missense probably damaging 0.96
R5407:Golga3 UTSW 5 110,349,856 (GRCm39) nonsense probably null
R5884:Golga3 UTSW 5 110,364,761 (GRCm39) missense probably damaging 1.00
R6526:Golga3 UTSW 5 110,352,761 (GRCm39) missense probably damaging 0.98
R6651:Golga3 UTSW 5 110,365,996 (GRCm39) nonsense probably null
R7041:Golga3 UTSW 5 110,356,450 (GRCm39) critical splice donor site probably null
R7057:Golga3 UTSW 5 110,336,529 (GRCm39) missense probably damaging 1.00
R7078:Golga3 UTSW 5 110,340,953 (GRCm39) missense probably damaging 0.99
R7114:Golga3 UTSW 5 110,350,578 (GRCm39) missense probably benign 0.01
R7190:Golga3 UTSW 5 110,357,721 (GRCm39) missense probably damaging 1.00
R7405:Golga3 UTSW 5 110,356,312 (GRCm39) missense probably damaging 0.97
R7528:Golga3 UTSW 5 110,360,098 (GRCm39) missense probably damaging 1.00
R7638:Golga3 UTSW 5 110,353,694 (GRCm39) missense probably benign
R7760:Golga3 UTSW 5 110,353,716 (GRCm39) missense probably benign 0.39
R8099:Golga3 UTSW 5 110,336,573 (GRCm39) nonsense probably null
R8144:Golga3 UTSW 5 110,333,745 (GRCm39) missense probably damaging 0.99
R8558:Golga3 UTSW 5 110,356,421 (GRCm39) missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110,350,721 (GRCm39) missense probably benign 0.05
R8887:Golga3 UTSW 5 110,353,626 (GRCm39) intron probably benign
R9039:Golga3 UTSW 5 110,352,799 (GRCm39) missense probably benign 0.00
R9045:Golga3 UTSW 5 110,340,963 (GRCm39) missense probably benign 0.00
R9057:Golga3 UTSW 5 110,332,465 (GRCm39) missense probably damaging 1.00
R9100:Golga3 UTSW 5 110,337,544 (GRCm39) missense probably benign 0.31
R9112:Golga3 UTSW 5 110,333,757 (GRCm39) missense probably benign 0.08
R9198:Golga3 UTSW 5 110,355,619 (GRCm39) missense probably benign 0.11
R9755:Golga3 UTSW 5 110,340,847 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GGTGATGGTAGAGGCATACC -3'
(R):5'- TTCAGGAAGGCCTTATCTCTAGATTG -3'

Sequencing Primer
(F):5'- ATACCGGCGAGATGCTACTTC -3'
(R):5'- AAAAGTCTTTCTTGGTCAATGCTCC -3'
Posted On 2017-08-16