Mutagenetix > Incidental Mutation

Incidental Mutation 'R6087:Golga3'

484605

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

MMRRC Submission

044244-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6087 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110204946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 861 (Q861L)

Ref Sequence

ENSEMBL: ENSMUSP00000108131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031477
AA Change: Q901L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: Q901L

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112512
AA Change: Q861L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: Q861L

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199123

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	G	5: 87,971,762	K126R	possibly damaging	Het
9330182L06Rik	T	C	5: 9,399,255	S128P	probably damaging	Het
Adam7	A	T	14: 68,510,757	C548S	probably damaging	Het
Adar	C	A	3: 89,745,590	H260N	probably benign	Het
Ak9	A	G	10: 41,382,832	E775G	probably benign	Het
Arhgap35	T	C	7: 16,563,643	Y499C	probably damaging	Het
Bank1	A	G	3: 136,066,429	L480P	probably damaging	Het
Cep135	G	T	5: 76,615,791		probably null	Het
Cnga1	G	T	5: 72,610,812	A177E	probably damaging	Het
Cubn	T	A	2: 13,427,847	D1221V	probably damaging	Het
Cyp2d40	T	C	15: 82,764,004	Y36C	possibly damaging	Het
Dock8	C	A	19: 25,161,074	N1254K	probably benign	Het
Fam13b	C	T	18: 34,487,139	V231I	possibly damaging	Het
Fbxo8	T	A	8: 56,569,318	Y122N	probably damaging	Het
Fmo2	T	A	1: 162,880,433	I378F	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ighv3-8	G	T	12: 114,322,380	A114E	probably damaging	Het
Itga3	C	T	11: 95,052,443		probably null	Het
Kank1	G	A	19: 25,409,724	V254I	probably benign	Het
Lipo5	A	T	19: 33,465,975	I147K	unknown	Het
Lrfn2	A	G	17: 49,071,126	S412G	probably benign	Het
Lrrn3	T	C	12: 41,453,535	N261S	possibly damaging	Het
Mical2	C	T	7: 112,318,485	Q350*	probably null	Het
Nras	T	C	3: 103,060,321	F78L	probably damaging	Het
Nudt9	A	G	5: 104,050,813	I65V	probably benign	Het
Olfr1129	A	G	2: 87,575,915	D277G	probably benign	Het
Olfr1293-ps	A	T	2: 111,528,181	E289V	possibly damaging	Het
Oscar	G	A	7: 3,611,312	P143S	probably benign	Het
Pla2g4d	C	T	2: 120,270,006	G615D	probably damaging	Het
Plekha1	T	G	7: 130,900,571	S175A	probably benign	Het
Psg27	T	C	7: 18,556,944	K445E	probably benign	Het
Rad51c	A	G	11: 87,380,879	Y318H	probably benign	Het
Ret	G	T	6: 118,176,291	T472K	possibly damaging	Het
Tarbp1	T	C	8: 126,428,970	D1343G	probably benign	Het
Top2b	C	A	14: 16,409,864	R844S	probably benign	Het
Vmn1r171	T	A	7: 23,633,004	M218K	probably damaging	Het
Vmn2r89	A	T	14: 51,457,576		probably null	Het
Zc3h13	T	A	14: 75,330,709	D1147E	probably damaging	Het
Zgrf1	T	A	3: 127,615,486	L1703H	probably damaging	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2153:Golga3	UTSW	5	110187990	splice site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3276:Golga3	UTSW	5	110201998	splice site	probably benign
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5399:Golga3	UTSW	5	110205024	missense	probably damaging	0.96
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7057:Golga3	UTSW	5	110188663	missense	probably damaging	1.00
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8558:Golga3	UTSW	5	110208555	missense	possibly damaging	0.83
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9045:Golga3	UTSW	5	110193097	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9112:Golga3	UTSW	5	110185891	missense	probably benign	0.08
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11
R9755:Golga3	UTSW	5	110192981	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- GGTGATGGTAGAGGCATACC -3'
(R):5'- TTCAGGAAGGCCTTATCTCTAGATTG -3'

Sequencing Primer
(F):5'- ATACCGGCGAGATGCTACTTC -3'
(R):5'- AAAAGTCTTTCTTGGTCAATGCTCC -3'

Posted On

2017-08-16