Incidental Mutation 'R6087:Ret'
ID484606
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Nameret proto-oncogene
Synonymsc-Ret, RET9, RET51
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location118151745-118197718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118176291 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 472 (T472K)
Ref Sequence ENSEMBL: ENSMUSP00000086169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032201
AA Change: T472K

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: T472K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088790
AA Change: T472K

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: T472K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118175120 splice site probably null
IGL02445:Ret APN 6 118181899 missense probably damaging 0.98
IGL02754:Ret APN 6 118176252 missense probably benign 0.03
IGL02828:Ret APN 6 118176207 missense probably benign 0.00
IGL03058:Ret APN 6 118175067 missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118164741 missense probably benign 0.04
R0126:Ret UTSW 6 118165995 splice site probably benign
R0555:Ret UTSW 6 118178610 missense probably damaging 0.96
R1168:Ret UTSW 6 118173558 missense possibly damaging 0.94
R1829:Ret UTSW 6 118153951 missense probably damaging 0.99
R2020:Ret UTSW 6 118180382 missense possibly damaging 0.63
R4082:Ret UTSW 6 118153966 missense possibly damaging 0.81
R4732:Ret UTSW 6 118163193 missense possibly damaging 0.77
R4733:Ret UTSW 6 118163193 missense possibly damaging 0.77
R5356:Ret UTSW 6 118197118 missense possibly damaging 0.73
R5401:Ret UTSW 6 118181975 missense probably benign 0.05
R5572:Ret UTSW 6 118155431 missense probably damaging 1.00
R5669:Ret UTSW 6 118184243 missense probably benign
R6058:Ret UTSW 6 118179319 missense probably benign
R6412:Ret UTSW 6 118184284 missense probably benign 0.00
R6457:Ret UTSW 6 118173621 missense probably benign 0.01
R6884:Ret UTSW 6 118155401 missense probably damaging 1.00
R7035:Ret UTSW 6 118163286 missense probably damaging 1.00
R7112:Ret UTSW 6 118197102 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTTTACACCGAAAGACACAGC -3'
(R):5'- AAGAGCCCATCCAGCTAAGG -3'

Sequencing Primer
(F):5'- GACACAGCGAACACATTGTCTG -3'
(R):5'- TAAGGTGCACTGGTACGATCCTC -3'
Posted On2017-08-16