Incidental Mutation 'R6087:Mical2'
ID484611
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms5330438E18Rik
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location112225856-112355194 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 112318485 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 350 (Q350*)
Ref Sequence ENSEMBL: ENSMUSP00000051163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
Predicted Effect probably null
Transcript: ENSMUST00000037991
AA Change: Q350*
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: Q350*

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000050149
AA Change: Q350*
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: Q350*

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106647
SMART Domains Protein: ENSMUSP00000102258
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:NAD_binding_7 83 172 5.9e-7 PFAM
Pfam:FAD_binding_3 86 144 5.9e-9 PFAM
Pfam:Pyr_redox 88 126 3.4e-6 PFAM
Pfam:FAD_binding_2 88 127 4.8e-7 PFAM
Pfam:Pyr_redox_2 88 245 2.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106648
SMART Domains Protein: ENSMUSP00000102259
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 9.5e-9 PFAM
Pfam:FAD_binding_2 88 127 1.3e-6 PFAM
Pfam:Pyr_redox_2 88 263 1e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 1.71e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150428
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Mical2 APN 7 112315072 missense probably benign 0.00
IGL00934:Mical2 APN 7 112349403 missense probably damaging 1.00
IGL00941:Mical2 APN 7 112321445 splice site probably benign
IGL01020:Mical2 APN 7 112315076 splice site probably benign
IGL01395:Mical2 APN 7 112323585 missense probably damaging 1.00
IGL01658:Mical2 APN 7 112314998 missense probably damaging 1.00
IGL02040:Mical2 APN 7 112311406 missense probably damaging 1.00
IGL02388:Mical2 APN 7 112335413 missense probably benign
IGL02551:Mical2 APN 7 112323990 missense probably benign 0.01
IGL02578:Mical2 APN 7 112351373 missense probably benign 0.05
IGL02751:Mical2 APN 7 112332036 missense probably benign 0.11
R0101:Mical2 UTSW 7 112336867 missense possibly damaging 0.86
R0504:Mical2 UTSW 7 112271317 missense probably benign 0.00
R0594:Mical2 UTSW 7 112318450 missense probably damaging 0.97
R0609:Mical2 UTSW 7 112321440 splice site probably null
R1542:Mical2 UTSW 7 112309468 missense probably damaging 1.00
R1740:Mical2 UTSW 7 112333836 missense probably benign
R1855:Mical2 UTSW 7 112345282 missense probably benign 0.21
R2086:Mical2 UTSW 7 112318603 missense probably benign 0.31
R2136:Mical2 UTSW 7 112271515 missense possibly damaging 0.72
R2418:Mical2 UTSW 7 112320734 critical splice donor site probably null
R3053:Mical2 UTSW 7 112311423 missense probably damaging 1.00
R4308:Mical2 UTSW 7 112331992 missense probably benign 0.27
R4663:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R4868:Mical2 UTSW 7 112318624 missense probably damaging 1.00
R4902:Mical2 UTSW 7 112336900 missense probably benign
R5112:Mical2 UTSW 7 112320611 missense probably damaging 1.00
R5487:Mical2 UTSW 7 112320635 missense probably damaging 1.00
R5563:Mical2 UTSW 7 112314978 missense probably damaging 1.00
R5817:Mical2 UTSW 7 112323659 missense probably benign
R5987:Mical2 UTSW 7 112334948 missense probably benign 0.00
R6209:Mical2 UTSW 7 112324086 splice site probably null
R6311:Mical2 UTSW 7 112323558 missense probably damaging 1.00
R6319:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R6578:Mical2 UTSW 7 112311445 missense probably damaging 1.00
R6782:Mical2 UTSW 7 112346761 missense probably damaging 1.00
R7061:Mical2 UTSW 7 112346801 missense probably benign 0.10
R7147:Mical2 UTSW 7 112323603 missense possibly damaging 0.77
R7260:Mical2 UTSW 7 112319794 missense probably benign 0.10
R7266:Mical2 UTSW 7 112303756 missense probably damaging 1.00
R7391:Mical2 UTSW 7 112320609 missense probably damaging 1.00
R7724:Mical2 UTSW 7 112323626 missense probably damaging 1.00
X0062:Mical2 UTSW 7 112346843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCTTCTGATCCACAGTG -3'
(R):5'- GCTATGAGCCTGAGAACAGATCC -3'

Sequencing Primer
(F):5'- TGGGTGTGAAGGCAGGCC -3'
(R):5'- CCTGAGAACAGATCCATAGGTCTG -3'
Posted On2017-08-16