Incidental Mutation 'R6087:Plekha1'
ID484612
Institutional Source Beutler Lab
Gene Symbol Plekha1
Ensembl Gene ENSMUSG00000040268
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
SynonymsTAPP1, C920009D07Rik
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location130865756-130913312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 130900571 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 175 (S175A)
Ref Sequence ENSEMBL: ENSMUSP00000074675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048180] [ENSMUST00000075181] [ENSMUST00000120441] [ENSMUST00000124096] [ENSMUST00000151119]
Predicted Effect probably benign
Transcript: ENSMUST00000048180
AA Change: S127A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035375
Gene: ENSMUSG00000040268
AA Change: S127A

DomainStartEndE-ValueType
PDB:1V5P|A 1 75 2e-33 PDB
Blast:PH 8 78 1e-36 BLAST
PH 144 243 1.71e-21 SMART
low complexity region 244 261 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075181
AA Change: S175A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074675
Gene: ENSMUSG00000040268
AA Change: S175A

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
low complexity region 330 341 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120441
AA Change: S175A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112777
Gene: ENSMUSG00000040268
AA Change: S175A

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126355
SMART Domains Protein: ENSMUSP00000114411
Gene: ENSMUSG00000040268

DomainStartEndE-ValueType
Pfam:PH 2 51 6e-8 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135359
Predicted Effect unknown
Transcript: ENSMUST00000136963
AA Change: S13A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149029
Predicted Effect unknown
Transcript: ENSMUST00000151119
AA Change: S175A
SMART Domains Protein: ENSMUSP00000123600
Gene: ENSMUSG00000040268
AA Change: S175A

DomainStartEndE-ValueType
PDB:1V5P|A 1 67 3e-35 PDB
Blast:PH 8 67 7e-38 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pleckstrin homology domain-containing adapter protein. The encoded protein is localized to the plasma membrane where it specifically binds phosphatidylinositol 3,4-bisphosphate. This protein may be involved in the formation of signaling complexes in the plasma membrane. Polymorphisms in this gene are associated with age-related macular degeneration. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mcie homozygous for a gene trapped allele exhibit postnatal lethality and increased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Plekha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Plekha1 APN 7 130877839 missense probably damaging 1.00
IGL00973:Plekha1 APN 7 130911013 missense probably damaging 0.96
IGL01010:Plekha1 APN 7 130902254 splice site probably benign
IGL01726:Plekha1 APN 7 130897329 missense probably damaging 1.00
R0137:Plekha1 UTSW 7 130897446 missense probably damaging 0.98
R0681:Plekha1 UTSW 7 130900623 missense possibly damaging 0.50
R1304:Plekha1 UTSW 7 130902219 missense probably benign
R1786:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R2036:Plekha1 UTSW 7 130902192 missense probably damaging 1.00
R2844:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2845:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2846:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R5119:Plekha1 UTSW 7 130905364 intron probably benign
R5167:Plekha1 UTSW 7 130885449 critical splice donor site probably null
R5470:Plekha1 UTSW 7 130908376 missense probably damaging 1.00
R5536:Plekha1 UTSW 7 130909601 missense probably damaging 0.96
R5975:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R6346:Plekha1 UTSW 7 130877782 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTTGTGGTTGATCAGGAACAAGG -3'
(R):5'- ACTGGGTGATAATCATGGGGC -3'

Sequencing Primer
(F):5'- GAAGTTGAGATTAAGTGTCACAGGC -3'
(R):5'- CTGGGTCTTTCAGAGAATAAAGCAC -3'
Posted On2017-08-16