Incidental Mutation 'R6087:Rad51c'
ID484616
Institutional Source Beutler Lab
Gene Symbol Rad51c
Ensembl Gene ENSMUSG00000007646
Gene NameRAD51 paralog C
SynonymsRad51l2
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87376645-87404954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87380879 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 318 (Y318H)
Ref Sequence ENSEMBL: ENSMUSP00000064079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007790] [ENSMUST00000067692] [ENSMUST00000129400] [ENSMUST00000153073]
Predicted Effect probably benign
Transcript: ENSMUST00000007790
AA Change: Y336H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000007790
Gene: ENSMUSG00000007646
AA Change: Y336H

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Rad51 91 359 1.7e-32 PFAM
Pfam:AAA_25 97 298 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067692
AA Change: Y318H

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000064079
Gene: ENSMUSG00000007646
AA Change: Y318H

DomainStartEndE-ValueType
Pfam:Rad51 73 341 1.9e-32 PFAM
Pfam:AAA_25 79 280 7.6e-10 PFAM
Pfam:KaiC 91 137 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129400
SMART Domains Protein: ENSMUSP00000121928
Gene: ENSMUSG00000007646

DomainStartEndE-ValueType
PDB:1PZN|G 10 125 2e-9 PDB
SCOP:d1g8ya_ 91 125 9e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153073
SMART Domains Protein: ENSMUSP00000122811
Gene: ENSMUSG00000007646

DomainStartEndE-ValueType
Pfam:Rad51 73 315 3.2e-28 PFAM
Pfam:AAA_25 79 280 2.1e-10 PFAM
Pfam:KaiC 91 137 1.7e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. Mice carrying a null and a hypomorphic allele have partial penetrance of male and female infertility due to defects in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Rad51c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Rad51c APN 11 87380855 missense possibly damaging 0.92
IGL03096:Rad51c APN 11 87388646 missense probably damaging 1.00
IGL03493:Rad51c APN 11 87397753 missense probably benign 0.00
R0415:Rad51c UTSW 11 87397655 missense probably damaging 0.99
R1875:Rad51c UTSW 11 87388643 missense probably damaging 0.99
R2098:Rad51c UTSW 11 87402763 missense probably benign
R4172:Rad51c UTSW 11 87402746 missense probably damaging 1.00
R4798:Rad51c UTSW 11 87395378 missense probably damaging 1.00
R5054:Rad51c UTSW 11 87397754 missense probably benign 0.06
R5182:Rad51c UTSW 11 87397719 missense possibly damaging 0.85
R5381:Rad51c UTSW 11 87397633 missense probably benign 0.00
R7066:Rad51c UTSW 11 87402676 missense possibly damaging 0.56
R7714:Rad51c UTSW 11 87401450 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGTTCTCACATCTAGACTATC -3'
(R):5'- TGTCTGAGACTGAAAGCACCC -3'

Sequencing Primer
(F):5'- AGACTATCCTCAAATATGCTTGCTGC -3'
(R):5'- AGTGCTGCCCTGTGAGGAAG -3'
Posted On2017-08-16