Incidental Mutation 'R6087:Cyp2d40'
ID484624
Institutional Source Beutler Lab
Gene Symbol Cyp2d40
Ensembl Gene ENSMUSG00000068083
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 40
Synonyms
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82759833-82764183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82764004 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 36 (Y36C)
Ref Sequence ENSEMBL: ENSMUSP00000060524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055721
AA Change: Y36C

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060524
Gene: ENSMUSG00000068083
AA Change: Y36C

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:p450 59 335 1.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230433
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Cyp2d40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2d40 APN 15 82760901 missense unknown
IGL01313:Cyp2d40 APN 15 82761277 missense unknown
IGL01714:Cyp2d40 APN 15 82761240 missense possibly damaging 0.55
IGL02324:Cyp2d40 APN 15 82760948 splice site probably benign
IGL02993:Cyp2d40 APN 15 82761521 missense probably benign 0.19
IGL03162:Cyp2d40 APN 15 82760042 missense unknown
R0070:Cyp2d40 UTSW 15 82760774 missense unknown
R0499:Cyp2d40 UTSW 15 82761217 missense probably benign 0.11
R0885:Cyp2d40 UTSW 15 82760915 missense unknown
R1587:Cyp2d40 UTSW 15 82761133 intron probably null
R1613:Cyp2d40 UTSW 15 82761439 missense unknown
R4773:Cyp2d40 UTSW 15 82761562 missense possibly damaging 0.73
R5047:Cyp2d40 UTSW 15 82760259 missense unknown
R5604:Cyp2d40 UTSW 15 82764055 missense probably damaging 0.99
R6334:Cyp2d40 UTSW 15 82761552 missense probably benign 0.03
R6841:Cyp2d40 UTSW 15 82761486 missense probably benign 0.03
R7017:Cyp2d40 UTSW 15 82760033 missense unknown
R7045:Cyp2d40 UTSW 15 82761562 missense probably benign 0.01
R7565:Cyp2d40 UTSW 15 82760774 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAACTTGGCCCGTTTAGAG -3'
(R):5'- AAGGTGGTAGGATCCAAGCTTG -3'

Sequencing Primer
(F):5'- CCCGTTTAGAGGTTCCAGATCG -3'
(R):5'- GGTCTTCCTGATCCAAGGTG -3'
Posted On2017-08-16