Incidental Mutation 'R6089:Dnah14'
ID484632
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission 044246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6089 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 181750154 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 3012 (W3012L)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160345
SMART Domains Protein: ENSMUSP00000124817
Gene: ENSMUSG00000047369

DomainStartEndE-ValueType
Pfam:MT 46 381 2.1e-41 PFAM
Pfam:AAA_9 401 524 8.3e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160793
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: W3012L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T G 7: 118,746,435 S59A possibly damaging Het
A830010M20Rik C T 5: 107,507,029 A386V probably damaging Het
Actr3 A G 1: 125,407,395 V95A probably damaging Het
Ankrd40 A T 11: 94,333,925 K53N probably damaging Het
Ash1l C T 3: 89,053,143 Q2338* probably null Het
Astn2 A G 4: 65,794,573 F610S probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Calm4 A T 13: 3,837,874 probably benign Het
Card10 T C 15: 78,802,414 T68A probably benign Het
Cars2 A G 8: 11,530,301 M245T probably damaging Het
Cat C A 2: 103,472,951 L160F probably null Het
Cers5 G T 15: 99,741,002 T144K probably benign Het
Cyp3a13 T A 5: 137,909,953 L211F probably benign Het
Defb4 A T 8: 19,201,305 R63* probably null Het
Dusp18 A G 11: 3,897,555 T182A probably benign Het
Dzip1l C A 9: 99,642,684 T286K possibly damaging Het
Eif2ak3 A T 6: 70,896,934 T944S possibly damaging Het
Fbn1 A T 2: 125,321,225 I2119N possibly damaging Het
Gabbr2 A G 4: 46,846,448 S154P probably damaging Het
Gm15440 A T 13: 51,691,401 H107Q unknown Het
Grm2 G A 9: 106,653,891 P133L probably damaging Het
Gsdme A G 6: 50,251,305 V61A probably damaging Het
Gtpbp1 A G 15: 79,706,997 T23A probably benign Het
Helz A T 11: 107,595,137 probably null Het
Herc1 A C 9: 66,445,532 H2100P probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ifngr1 T C 10: 19,606,300 S213P probably benign Het
Itgb7 T C 15: 102,217,286 D636G probably benign Het
Mre11a G A 9: 14,819,464 D491N probably benign Het
Muc16 A G 9: 18,643,252 L3915P unknown Het
Myh1 T A 11: 67,202,167 probably null Het
Myh1 T G 11: 67,220,787 probably null Het
Myh7b C T 2: 155,622,489 T608M probably damaging Het
Myof T C 19: 37,967,060 K23E probably benign Het
Nacad A G 11: 6,601,331 V620A probably benign Het
Pbrm1 T C 14: 31,087,585 Y1121H probably damaging Het
Pcdha9 T C 18: 36,998,498 F207L probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Pigg A T 5: 108,341,922 M798L probably benign Het
Poc5 G T 13: 96,396,671 M102I probably damaging Het
Ppp2r3a T A 9: 101,211,636 Q496L probably benign Het
Ptprf A G 4: 118,211,084 Y1752H probably damaging Het
Ptpru G C 4: 131,772,630 S1244R possibly damaging Het
Rnf213 A G 11: 119,416,559 K682E probably benign Het
Rtp3 T C 9: 110,986,973 D170G probably benign Het
Sall4 T C 2: 168,755,486 D478G possibly damaging Het
Scai A T 2: 39,083,554 Y58* probably null Het
Simc1 G A 13: 54,528,490 V1007M probably benign Het
Tcf20 G T 15: 82,853,208 D1347E probably benign Het
Tdo2 T C 3: 81,962,728 Y279C probably damaging Het
Trdn C T 10: 33,464,575 P602S probably benign Het
Txndc5 A T 13: 38,523,416 M1K probably null Het
Ubr2 A C 17: 46,982,292 M356R possibly damaging Het
Uqcrc2 A T 7: 120,654,009 D332V probably damaging Het
Usp48 T C 4: 137,605,818 F108L probably damaging Het
Vill A G 9: 119,057,799 N4S probably benign Het
Vmn1r11 T C 6: 57,137,660 V103A possibly damaging Het
Vmn2r98 A G 17: 19,066,074 D278G probably benign Het
Wfdc15a A T 2: 164,199,666 L79* probably null Het
Xxylt1 C T 16: 31,080,981 V119M probably damaging Het
Zfp26 G T 9: 20,437,693 A525D probably damaging Het
Zgrf1 G A 3: 127,595,993 G396D probably damaging Het
Zkscan16 A G 4: 58,948,889 D148G possibly damaging Het
Zscan26 G T 13: 21,448,329 S77R probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 intron probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7925:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7944:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTGGCTATGTTGACTGG -3'
(R):5'- ACGCCATCTTCCATGTGTG -3'

Sequencing Primer
(F):5'- AACGTGGCTATGTTGACTGGTATTC -3'
(R):5'- TGTAAATACGGACCCAGC -3'
Posted On2017-08-16