Incidental Mutation 'R0520:Apaf1'
ID48465
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0520 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91079989 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 12 (H12Q)
Ref Sequence ENSEMBL: ENSMUSP00000124422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020149] [ENSMUST00000020150] [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000160788] [ENSMUST00000161987] [ENSMUST00000162618]
Predicted Effect probably benign
Transcript: ENSMUST00000020149
SMART Domains Protein: ENSMUSP00000020149
Gene: ENSMUSG00000019975

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
coiled coil region 80 154 N/A INTRINSIC
coiled coil region 175 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000020150
SMART Domains Protein: ENSMUSP00000020150
Gene: ENSMUSG00000019975

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
coiled coil region 89 109 N/A INTRINSIC
coiled coil region 234 261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000020157
AA Change: H12Q

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: H12Q

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135152
Predicted Effect possibly damaging
Transcript: ENSMUST00000159110
AA Change: H12Q

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: H12Q

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160788
AA Change: H12Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124968
Gene: ENSMUSG00000019979
AA Change: H12Q

DomainStartEndE-ValueType
Pfam:CARD 6 90 1e-21 PFAM
Pfam:NB-ARC 129 238 6.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161987
AA Change: H12Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124422
Gene: ENSMUSG00000019979
AA Change: H12Q

DomainStartEndE-ValueType
Pfam:CARD 6 90 1e-21 PFAM
Pfam:NB-ARC 129 238 6.9e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162618
AA Change: H12Q

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: H12Q

DomainStartEndE-ValueType
Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Meta Mutation Damage Score 0.1662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acod1 T C 14: 103,051,516 I154T possibly damaging Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Asic1 A T 15: 99,695,535 I291F probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Asxl3 A T 18: 22,522,986 D1351V probably damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Fggy T A 4: 95,601,103 L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
Krtap19-2 C T 16: 88,873,861 probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr871 G A 9: 20,212,495 V49I probably benign Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Plekhm1 T C 11: 103,394,944 I222V probably benign Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
wipeout UTSW 10 91056000 missense probably damaging 1.00
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R0734:Apaf1 UTSW 10 91037021 missense probably benign 0.02
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1459:Apaf1 UTSW 10 91062160 missense probably benign 0.00
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2006:Apaf1 UTSW 10 91061772 missense probably damaging 1.00
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2153:Apaf1 UTSW 10 91048090 missense probably damaging 1.00
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5497:Apaf1 UTSW 10 90999656 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7423:Apaf1 UTSW 10 91059606 missense probably damaging 1.00
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
R7765:Apaf1 UTSW 10 91023782 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGAACGAACAGGCGAATATGTCTGC -3'
(R):5'- TGAAGTTACACATCCGGCGCTCAC -3'

Sequencing Primer
(F):5'- aattcaattcccagcaaccac -3'
(R):5'- GCGCTCACACATCCTGTTG -3'
Posted On2013-06-12