Incidental Mutation 'R0520:Plekhm1'
ID48468
Institutional Source Beutler Lab
Gene Symbol Plekhm1
Ensembl Gene ENSMUSG00000034247
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 1
SynonymsB2, D330036J23Rik, AP162
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0520 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103364275-103412687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103394944 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 222 (I222V)
Ref Sequence ENSEMBL: ENSMUSP00000047327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041272]
Predicted Effect probably benign
Transcript: ENSMUST00000041272
AA Change: I222V

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: I222V

DomainStartEndE-ValueType
RUN 117 180 3.36e-20 SMART
low complexity region 246 273 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Blast:DUF4206 448 543 2e-11 BLAST
PH 552 644 2.16e-9 SMART
low complexity region 658 674 N/A INTRINSIC
PH 702 797 2.15e-4 SMART
DUF4206 864 1068 7.51e-103 SMART
C1 1005 1058 2.72e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184350
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acod1 T C 14: 103,051,516 I154T possibly damaging Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Apaf1 A T 10: 91,079,989 H12Q probably damaging Het
Asic1 A T 15: 99,695,535 I291F probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Asxl3 A T 18: 22,522,986 D1351V probably damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Fggy T A 4: 95,601,103 L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
Krtap19-2 C T 16: 88,873,861 probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr871 G A 9: 20,212,495 V49I probably benign Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Plekhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Plekhm1 APN 11 103394783 missense possibly damaging 0.54
IGL01876:Plekhm1 APN 11 103376751 missense probably damaging 1.00
IGL02159:Plekhm1 APN 11 103380231 missense probably benign 0.04
IGL02404:Plekhm1 APN 11 103394998 missense probably benign 0.18
IGL02537:Plekhm1 APN 11 103397192 missense probably damaging 1.00
IGL02568:Plekhm1 APN 11 103395050 missense probably damaging 1.00
IGL02660:Plekhm1 APN 11 103374094 splice site probably benign
IGL03130:Plekhm1 APN 11 103377381 missense probably benign 0.17
IGL03208:Plekhm1 APN 11 103376770 missense probably benign 0.00
R0442:Plekhm1 UTSW 11 103397174 missense possibly damaging 0.45
R0491:Plekhm1 UTSW 11 103394776 missense probably benign 0.05
R0964:Plekhm1 UTSW 11 103395082 nonsense probably null
R1189:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1501:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1697:Plekhm1 UTSW 11 103376884 missense probably damaging 1.00
R1781:Plekhm1 UTSW 11 103394856 missense probably damaging 1.00
R1873:Plekhm1 UTSW 11 103373998 missense probably benign 0.01
R2087:Plekhm1 UTSW 11 103397025 critical splice donor site probably null
R2215:Plekhm1 UTSW 11 103376985 missense probably damaging 1.00
R2271:Plekhm1 UTSW 11 103387122 missense probably benign 0.00
R4256:Plekhm1 UTSW 11 103370934 missense probably damaging 0.98
R4393:Plekhm1 UTSW 11 103376965 missense possibly damaging 0.51
R4526:Plekhm1 UTSW 11 103395304 missense probably damaging 0.97
R5119:Plekhm1 UTSW 11 103387315 missense possibly damaging 0.62
R5975:Plekhm1 UTSW 11 103376691 missense possibly damaging 0.49
R6389:Plekhm1 UTSW 11 103366894 missense probably benign 0.21
R6454:Plekhm1 UTSW 11 103377382 missense probably damaging 1.00
R6755:Plekhm1 UTSW 11 103387243 missense possibly damaging 0.65
R6830:Plekhm1 UTSW 11 103376889 missense probably damaging 0.97
R7039:Plekhm1 UTSW 11 103395228 missense probably damaging 1.00
R7066:Plekhm1 UTSW 11 103370988 missense possibly damaging 0.47
R7149:Plekhm1 UTSW 11 103394916 missense probably damaging 0.98
R7349:Plekhm1 UTSW 11 103387334 missense probably damaging 0.98
R7505:Plekhm1 UTSW 11 103380029 splice site probably null
R7792:Plekhm1 UTSW 11 103397060 missense probably damaging 0.99
R7867:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
R7950:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
X0058:Plekhm1 UTSW 11 103377366 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGGACCATTCTCTTGGAGCAG -3'
(R):5'- TGTGCGAGTACTATCAGCCCACAG -3'

Sequencing Primer
(F):5'- ATTCTCTTGGAGCAGGCAGC -3'
(R):5'- ACAGCCCTGCTTCGAGATG -3'
Posted On2013-06-12