Incidental Mutation 'R6089:Poc5'
ID484682
Institutional Source Beutler Lab
Gene Symbol Poc5
Ensembl Gene ENSMUSG00000021671
Gene NamePOC5 centriolar protein
Synonyms
MMRRC Submission 044246-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6089 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96388294-96417737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96396671 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 102 (M102I)
Ref Sequence ENSEMBL: ENSMUSP00000096898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099295]
Predicted Effect probably damaging
Transcript: ENSMUST00000099295
AA Change: M102I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096898
Gene: ENSMUSG00000021671
AA Change: M102I

DomainStartEndE-ValueType
coiled coil region 175 206 N/A INTRINSIC
coiled coil region 300 341 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222640
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T G 7: 118,746,435 S59A possibly damaging Het
A830010M20Rik C T 5: 107,507,029 A386V probably damaging Het
Actr3 A G 1: 125,407,395 V95A probably damaging Het
Ankrd40 A T 11: 94,333,925 K53N probably damaging Het
Ash1l C T 3: 89,053,143 Q2338* probably null Het
Astn2 A G 4: 65,794,573 F610S probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Calm4 A T 13: 3,837,874 probably benign Het
Card10 T C 15: 78,802,414 T68A probably benign Het
Cars2 A G 8: 11,530,301 M245T probably damaging Het
Cat C A 2: 103,472,951 L160F probably null Het
Cers5 G T 15: 99,741,002 T144K probably benign Het
Cyp3a13 T A 5: 137,909,953 L211F probably benign Het
Defb4 A T 8: 19,201,305 R63* probably null Het
Dnah14 G T 1: 181,750,154 W3012L probably damaging Het
Dusp18 A G 11: 3,897,555 T182A probably benign Het
Dzip1l C A 9: 99,642,684 T286K possibly damaging Het
Eif2ak3 A T 6: 70,896,934 T944S possibly damaging Het
Fbn1 A T 2: 125,321,225 I2119N possibly damaging Het
Gabbr2 A G 4: 46,846,448 S154P probably damaging Het
Gm15440 A T 13: 51,691,401 H107Q unknown Het
Grm2 G A 9: 106,653,891 P133L probably damaging Het
Gsdme A G 6: 50,251,305 V61A probably damaging Het
Gtpbp1 A G 15: 79,706,997 T23A probably benign Het
Helz A T 11: 107,595,137 probably null Het
Herc1 A C 9: 66,445,532 H2100P probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ifngr1 T C 10: 19,606,300 S213P probably benign Het
Itgb7 T C 15: 102,217,286 D636G probably benign Het
Mre11a G A 9: 14,819,464 D491N probably benign Het
Muc16 A G 9: 18,643,252 L3915P unknown Het
Myh1 T A 11: 67,202,167 probably null Het
Myh1 T G 11: 67,220,787 probably null Het
Myh7b C T 2: 155,622,489 T608M probably damaging Het
Myof T C 19: 37,967,060 K23E probably benign Het
Nacad A G 11: 6,601,331 V620A probably benign Het
Pbrm1 T C 14: 31,087,585 Y1121H probably damaging Het
Pcdha9 T C 18: 36,998,498 F207L probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Pigg A T 5: 108,341,922 M798L probably benign Het
Ppp2r3a T A 9: 101,211,636 Q496L probably benign Het
Ptprf A G 4: 118,211,084 Y1752H probably damaging Het
Ptpru G C 4: 131,772,630 S1244R possibly damaging Het
Rnf213 A G 11: 119,416,559 K682E probably benign Het
Rtp3 T C 9: 110,986,973 D170G probably benign Het
Sall4 T C 2: 168,755,486 D478G possibly damaging Het
Scai A T 2: 39,083,554 Y58* probably null Het
Simc1 G A 13: 54,528,490 V1007M probably benign Het
Tcf20 G T 15: 82,853,208 D1347E probably benign Het
Tdo2 T C 3: 81,962,728 Y279C probably damaging Het
Trdn C T 10: 33,464,575 P602S probably benign Het
Txndc5 A T 13: 38,523,416 M1K probably null Het
Ubr2 A C 17: 46,982,292 M356R possibly damaging Het
Uqcrc2 A T 7: 120,654,009 D332V probably damaging Het
Usp48 T C 4: 137,605,818 F108L probably damaging Het
Vill A G 9: 119,057,799 N4S probably benign Het
Vmn1r11 T C 6: 57,137,660 V103A possibly damaging Het
Vmn2r98 A G 17: 19,066,074 D278G probably benign Het
Wfdc15a A T 2: 164,199,666 L79* probably null Het
Xxylt1 C T 16: 31,080,981 V119M probably damaging Het
Zfp26 G T 9: 20,437,693 A525D probably damaging Het
Zgrf1 G A 3: 127,595,993 G396D probably damaging Het
Zkscan16 A G 4: 58,948,889 D148G possibly damaging Het
Zscan26 G T 13: 21,448,329 S77R probably damaging Het
Other mutations in Poc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Poc5 APN 13 96410746 missense probably damaging 1.00
IGL01377:Poc5 APN 13 96401631 missense probably benign 0.35
IGL02981:Poc5 APN 13 96401757 critical splice donor site probably null
IGL03031:Poc5 APN 13 96401615 missense probably benign 0.00
R0348:Poc5 UTSW 13 96398866 missense probably null 1.00
R1533:Poc5 UTSW 13 96391644 missense probably damaging 0.96
R1881:Poc5 UTSW 13 96398731 missense probably benign 0.21
R2171:Poc5 UTSW 13 96410749 missense probably damaging 1.00
R2337:Poc5 UTSW 13 96410603 missense probably damaging 0.98
R3419:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R3736:Poc5 UTSW 13 96396816 missense probably damaging 1.00
R4554:Poc5 UTSW 13 96403021 missense probably benign 0.40
R5223:Poc5 UTSW 13 96402955 missense probably benign 0.20
R5436:Poc5 UTSW 13 96396813 missense probably damaging 1.00
R6700:Poc5 UTSW 13 96394495 missense probably benign 0.00
R7345:Poc5 UTSW 13 96396796 missense probably damaging 1.00
R7354:Poc5 UTSW 13 96394525 missense probably benign 0.02
R7363:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R7454:Poc5 UTSW 13 96400832 missense possibly damaging 0.93
R7773:Poc5 UTSW 13 96410635 missense probably damaging 1.00
R7786:Poc5 UTSW 13 96404519 missense possibly damaging 0.55
R7953:Poc5 UTSW 13 96402900 missense probably benign 0.27
X0019:Poc5 UTSW 13 96394548 frame shift probably null
X0024:Poc5 UTSW 13 96394548 frame shift probably null
X0034:Poc5 UTSW 13 96394548 frame shift probably null
X0035:Poc5 UTSW 13 96394548 frame shift probably null
X0036:Poc5 UTSW 13 96394548 frame shift probably null
X0037:Poc5 UTSW 13 96394548 frame shift probably null
X0038:Poc5 UTSW 13 96394548 frame shift probably null
X0039:Poc5 UTSW 13 96394548 frame shift probably null
X0040:Poc5 UTSW 13 96394548 frame shift probably null
X0052:Poc5 UTSW 13 96394548 frame shift probably null
X0053:Poc5 UTSW 13 96394548 frame shift probably null
X0054:Poc5 UTSW 13 96394548 frame shift probably null
X0058:Poc5 UTSW 13 96394548 frame shift probably null
X0060:Poc5 UTSW 13 96394548 frame shift probably null
X0061:Poc5 UTSW 13 96394548 frame shift probably null
X0062:Poc5 UTSW 13 96394548 frame shift probably null
X0063:Poc5 UTSW 13 96394548 frame shift probably null
Z1176:Poc5 UTSW 13 96401722 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATCCAAATGCCCATGCTGAAG -3'
(R):5'- GGTGTCAGAATATAAAGCAACTGC -3'

Sequencing Primer
(F):5'- GCCCATGCTGAAGTATGTATACC -3'
(R):5'- GCAACTGCAACTAAGAGCTATAATAC -3'
Posted On2017-08-16