Incidental Mutation 'R6089:Gtpbp1'
ID484685
Institutional Source Beutler Lab
Gene Symbol Gtpbp1
Ensembl Gene ENSMUSG00000042535
Gene NameGTP binding protein 1
SynonymsGP-1, GTPBP1
MMRRC Submission 044246-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6089 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79690845-79721479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79706997 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000155128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046463] [ENSMUST00000229046] [ENSMUST00000230262] [ENSMUST00000230898] [ENSMUST00000231095]
Predicted Effect probably benign
Transcript: ENSMUST00000046463
AA Change: T104A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043575
Gene: ENSMUSG00000042535
AA Change: T104A

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
Pfam:GTP_EFTU 160 385 2.7e-24 PFAM
low complexity region 402 420 N/A INTRINSIC
SCOP:d1exma2 491 575 4e-19 SMART
low complexity region 605 619 N/A INTRINSIC
low complexity region 645 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229046
AA Change: T23A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230023
Predicted Effect probably benign
Transcript: ENSMUST00000230262
AA Change: T32A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000230898
AA Change: T23A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000231095
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated by interferon-gamma and encodes a protein that is a member of the AGP11/GTPBP1 family of GTP-binding proteins. A structurally similar protein has been found in mouse, where disruption of the gene for that protein had no observable phenotype. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted null mutation were viable and fertile with no obvious morphological or behavioral defects. In addition, no defects in macrophage function were observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T G 7: 118,746,435 S59A possibly damaging Het
A830010M20Rik C T 5: 107,507,029 A386V probably damaging Het
Actr3 A G 1: 125,407,395 V95A probably damaging Het
Ankrd40 A T 11: 94,333,925 K53N probably damaging Het
Ash1l C T 3: 89,053,143 Q2338* probably null Het
Astn2 A G 4: 65,794,573 F610S probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Calm4 A T 13: 3,837,874 probably benign Het
Card10 T C 15: 78,802,414 T68A probably benign Het
Cars2 A G 8: 11,530,301 M245T probably damaging Het
Cat C A 2: 103,472,951 L160F probably null Het
Cers5 G T 15: 99,741,002 T144K probably benign Het
Cyp3a13 T A 5: 137,909,953 L211F probably benign Het
Defb4 A T 8: 19,201,305 R63* probably null Het
Dnah14 G T 1: 181,750,154 W3012L probably damaging Het
Dusp18 A G 11: 3,897,555 T182A probably benign Het
Dzip1l C A 9: 99,642,684 T286K possibly damaging Het
Eif2ak3 A T 6: 70,896,934 T944S possibly damaging Het
Fbn1 A T 2: 125,321,225 I2119N possibly damaging Het
Gabbr2 A G 4: 46,846,448 S154P probably damaging Het
Gm15440 A T 13: 51,691,401 H107Q unknown Het
Grm2 G A 9: 106,653,891 P133L probably damaging Het
Gsdme A G 6: 50,251,305 V61A probably damaging Het
Helz A T 11: 107,595,137 probably null Het
Herc1 A C 9: 66,445,532 H2100P probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ifngr1 T C 10: 19,606,300 S213P probably benign Het
Itgb7 T C 15: 102,217,286 D636G probably benign Het
Mre11a G A 9: 14,819,464 D491N probably benign Het
Muc16 A G 9: 18,643,252 L3915P unknown Het
Myh1 T A 11: 67,202,167 probably null Het
Myh1 T G 11: 67,220,787 probably null Het
Myh7b C T 2: 155,622,489 T608M probably damaging Het
Myof T C 19: 37,967,060 K23E probably benign Het
Nacad A G 11: 6,601,331 V620A probably benign Het
Pbrm1 T C 14: 31,087,585 Y1121H probably damaging Het
Pcdha9 T C 18: 36,998,498 F207L probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Pigg A T 5: 108,341,922 M798L probably benign Het
Poc5 G T 13: 96,396,671 M102I probably damaging Het
Ppp2r3a T A 9: 101,211,636 Q496L probably benign Het
Ptprf A G 4: 118,211,084 Y1752H probably damaging Het
Ptpru G C 4: 131,772,630 S1244R possibly damaging Het
Rnf213 A G 11: 119,416,559 K682E probably benign Het
Rtp3 T C 9: 110,986,973 D170G probably benign Het
Sall4 T C 2: 168,755,486 D478G possibly damaging Het
Scai A T 2: 39,083,554 Y58* probably null Het
Simc1 G A 13: 54,528,490 V1007M probably benign Het
Tcf20 G T 15: 82,853,208 D1347E probably benign Het
Tdo2 T C 3: 81,962,728 Y279C probably damaging Het
Trdn C T 10: 33,464,575 P602S probably benign Het
Txndc5 A T 13: 38,523,416 M1K probably null Het
Ubr2 A C 17: 46,982,292 M356R possibly damaging Het
Uqcrc2 A T 7: 120,654,009 D332V probably damaging Het
Usp48 T C 4: 137,605,818 F108L probably damaging Het
Vill A G 9: 119,057,799 N4S probably benign Het
Vmn1r11 T C 6: 57,137,660 V103A possibly damaging Het
Vmn2r98 A G 17: 19,066,074 D278G probably benign Het
Wfdc15a A T 2: 164,199,666 L79* probably null Het
Xxylt1 C T 16: 31,080,981 V119M probably damaging Het
Zfp26 G T 9: 20,437,693 A525D probably damaging Het
Zgrf1 G A 3: 127,595,993 G396D probably damaging Het
Zkscan16 A G 4: 58,948,889 D148G possibly damaging Het
Zscan26 G T 13: 21,448,329 S77R probably damaging Het
Other mutations in Gtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Gtpbp1 APN 15 79719136 missense possibly damaging 0.90
IGL01783:Gtpbp1 APN 15 79716197 missense probably damaging 1.00
IGL01794:Gtpbp1 APN 15 79716246 missense probably damaging 1.00
IGL01859:Gtpbp1 APN 15 79719140 missense probably benign
IGL02245:Gtpbp1 APN 15 79690926 missense probably benign 0.02
IGL02532:Gtpbp1 APN 15 79720077 missense probably benign 0.05
IGL02730:Gtpbp1 APN 15 79719171 missense probably benign
IGL02796:Gtpbp1 UTSW 15 79716985 missense possibly damaging 0.83
R0525:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0531:Gtpbp1 UTSW 15 79720091 missense probably damaging 1.00
R0535:Gtpbp1 UTSW 15 79707732 missense probably damaging 1.00
R0665:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0760:Gtpbp1 UTSW 15 79719155 missense probably damaging 0.99
R0799:Gtpbp1 UTSW 15 79716200 missense probably damaging 1.00
R1445:Gtpbp1 UTSW 15 79713448 missense possibly damaging 0.82
R1458:Gtpbp1 UTSW 15 79707729 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1498:Gtpbp1 UTSW 15 79719021 splice site probably null
R1567:Gtpbp1 UTSW 15 79712190 missense probably damaging 0.98
R3028:Gtpbp1 UTSW 15 79715879 missense possibly damaging 0.64
R4431:Gtpbp1 UTSW 15 79716197 missense probably damaging 1.00
R4583:Gtpbp1 UTSW 15 79715951 missense possibly damaging 0.64
R4854:Gtpbp1 UTSW 15 79719205 missense probably benign
R4925:Gtpbp1 UTSW 15 79715968 missense probably benign 0.23
R5023:Gtpbp1 UTSW 15 79719221 missense possibly damaging 0.49
R5052:Gtpbp1 UTSW 15 79715969 missense probably damaging 1.00
R5695:Gtpbp1 UTSW 15 79712174 unclassified probably null
R6009:Gtpbp1 UTSW 15 79712096 missense probably damaging 1.00
R7088:Gtpbp1 UTSW 15 79719282 missense
R7343:Gtpbp1 UTSW 15 79691042 missense probably benign 0.03
R7383:Gtpbp1 UTSW 15 79716153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTGCCCAGATATGAGG -3'
(R):5'- ATTCTCTGTGAAGACCCCAAGTC -3'

Sequencing Primer
(F):5'- TATGAGGGGAAGCTGTGGCC -3'
(R):5'- AAGTGTTCTGAGACCTTACCTGAC -3'
Posted On2017-08-16