Incidental Mutation 'R6109:Rad9b'
ID484709
Institutional Source Beutler Lab
Gene Symbol Rad9b
Ensembl Gene ENSMUSG00000038569
Gene NameRAD9 checkpoint clamp component B
SynonymsA630082N15Rik
MMRRC Submission 044259-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6109 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122323223-122354233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122344297 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 125 (G125D)
Ref Sequence ENSEMBL: ENSMUSP00000036177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049009] [ENSMUST00000117263]
Predicted Effect probably damaging
Transcript: ENSMUST00000049009
AA Change: G125D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036177
Gene: ENSMUSG00000038569
AA Change: G125D

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.8e-91 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000117263
AA Change: G69D
SMART Domains Protein: ENSMUSP00000113868
Gene: ENSMUSG00000038569
AA Change: G69D

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.1e-93 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149600
AA Change: G12D
SMART Domains Protein: ENSMUSP00000120843
Gene: ENSMUSG00000038569
AA Change: G12D

DomainStartEndE-ValueType
Pfam:Rad9 1 85 4.3e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, decreased forebrain and somite cell proliferation, and increased cellular sensitivity to gamma irradiation and mitomycin C. Mice heterozygous for a knock-out allele exhibit reduced embryonic, fetal, and early postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,101,912 M131V possibly damaging Het
Abcc10 T C 17: 46,310,377 Y950C probably benign Het
Acadm A G 3: 153,941,943 C20R probably damaging Het
Agtpbp1 G T 13: 59,473,746 T984K probably damaging Het
Agxt2 C T 15: 10,377,422 T136I probably damaging Het
Ankrd36 C A 11: 5,628,941 N68K probably damaging Het
Ap3b2 T A 7: 81,493,592 D10V possibly damaging Het
Apcdd1 A T 18: 62,937,366 I235F probably damaging Het
Arhgap32 T A 9: 32,260,111 W1396R probably damaging Het
Ascc3 A G 10: 50,649,247 T513A probably benign Het
Aym1 C T 5: 113,357,541 L9F unknown Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Camk2a A T 18: 60,943,234 K95* probably null Het
Ccdc40 T C 11: 119,231,978 V202A probably benign Het
Cd200r3 T A 16: 44,953,682 D152E probably benign Het
Cd2bp2 C T 7: 127,194,815 D101N probably damaging Het
Cdh20 G A 1: 104,994,014 D679N probably damaging Het
Clpx C T 9: 65,299,952 T44I probably benign Het
Cnnm4 T G 1: 36,498,479 V541G probably damaging Het
Csmd1 T C 8: 16,199,860 I1035V possibly damaging Het
Ctsw T C 19: 5,467,119 S62G probably benign Het
Dlk2 T A 17: 46,301,697 Y109N probably damaging Het
Ebf3 C T 7: 137,206,226 V363M probably damaging Het
Farsb A G 1: 78,463,270 probably null Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gk5 C A 9: 96,140,610 F166L probably benign Het
Gm11271 G T 13: 21,381,139 noncoding transcript Het
Gm5294 C A 5: 138,820,095 Q6K probably damaging Het
Gnat2 T A 3: 108,100,135 Y290N probably damaging Het
H2-D1 A T 17: 35,263,937 I148F probably damaging Het
Hdac2 A G 10: 36,986,389 D83G probably null Het
Kdm5d T C Y: 921,501 W500R probably damaging Het
Kel A T 6: 41,688,862 F489I probably benign Het
Kmo C A 1: 175,637,908 A76E possibly damaging Het
Krt32 T C 11: 100,087,965 T88A probably benign Het
Lce3b A G 3: 92,933,687 T30A unknown Het
Lcn11 A G 2: 25,779,296 H155R possibly damaging Het
Lmln T A 16: 33,069,111 I129N possibly damaging Het
Meiob A G 17: 24,813,019 K3E probably benign Het
Mitf C T 6: 97,996,468 T229M probably damaging Het
Muc16 T C 9: 18,655,359 I1955V unknown Het
Naip1 A G 13: 100,427,182 C492R probably damaging Het
Ncor2 C T 5: 125,055,846 A26T probably damaging Het
Ngfr T G 11: 95,578,057 D165A probably damaging Het
Nobox A T 6: 43,305,169 S323R probably damaging Het
Olfr616 T C 7: 103,565,139 I47V probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Olfr937 A G 9: 39,060,196 S157P probably benign Het
Pcdhb1 G T 18: 37,265,253 V86F possibly damaging Het
Pdk1 A G 2: 71,883,506 E165G probably benign Het
Peak1 C T 9: 56,259,283 V454I probably benign Het
S100a16 T C 3: 90,542,074 F19L probably damaging Het
Serpine2 T C 1: 79,810,671 K190E probably damaging Het
Slf1 A T 13: 77,126,680 M12K probably damaging Het
Tex101 T C 7: 24,668,313 T205A possibly damaging Het
Tssk5 T C 15: 76,373,716 E147G probably damaging Het
Ubr4 A G 4: 139,417,364 T1495A probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Wdr70 A T 15: 8,079,154 probably null Het
Zfp811 T A 17: 32,797,374 probably null Het
Zscan10 T A 17: 23,607,129 F88L probably damaging Het
Other mutations in Rad9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Rad9b APN 5 122344247 missense probably benign 0.01
IGL02375:Rad9b APN 5 122333342 missense possibly damaging 0.71
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0975:Rad9b UTSW 5 122334257 splice site probably null
R2006:Rad9b UTSW 5 122339779 missense possibly damaging 0.74
R2265:Rad9b UTSW 5 122351342 missense probably damaging 0.98
R4818:Rad9b UTSW 5 122339776 missense probably damaging 1.00
R5392:Rad9b UTSW 5 122351578 missense probably damaging 1.00
R6041:Rad9b UTSW 5 122351352 missense probably damaging 0.99
R6133:Rad9b UTSW 5 122339768 missense possibly damaging 0.79
R6566:Rad9b UTSW 5 122352567 missense probably damaging 1.00
R6695:Rad9b UTSW 5 122351691 missense probably damaging 1.00
R7295:Rad9b UTSW 5 122334278 missense possibly damaging 0.95
R7299:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
R7301:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
R8495:Rad9b UTSW 5 122333033 splice site probably null
Z1088:Rad9b UTSW 5 122333372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACAGAACCCCAGCATTTTG -3'
(R):5'- ACAACGCGTTTCATGATTAGG -3'

Sequencing Primer
(F):5'- AGAACCCCAGCATTTTGTGTGC -3'
(R):5'- ATGATTAGGGCCACATTCCACTG -3'
Posted On2017-08-16