Incidental Mutation 'R6109:Mitf'
ID484714
Institutional Source Beutler Lab
Gene Symbol Mitf
Ensembl Gene ENSMUSG00000035158
Gene Namemelanogenesis associated transcription factor
Synonymswh, mi, Gsfbcc2, bHLHe32, BCC2
MMRRC Submission 044259-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R6109 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location97807052-98021349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97996468 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 229 (T229M)
Ref Sequence ENSEMBL: ENSMUSP00000108965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043628] [ENSMUST00000043637] [ENSMUST00000101123] [ENSMUST00000113339] [ENSMUST00000139462] [ENSMUST00000203884] [ENSMUST00000203938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043628
AA Change: T147M

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044459
Gene: ENSMUSG00000035158
AA Change: T147M

DomainStartEndE-ValueType
HLH 210 263 5.53e-17 SMART
Pfam:DUF3371 290 416 9.5e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000043637
AA Change: T254M

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044938
Gene: ENSMUSG00000035158
AA Change: T254M

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 3.1e-52 PFAM
HLH 317 370 5.53e-17 SMART
Pfam:DUF3371 397 522 2.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101123
AA Change: T238M

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098683
Gene: ENSMUSG00000035158
AA Change: T238M

DomainStartEndE-ValueType
coiled coil region 44 74 N/A INTRINSIC
HLH 301 354 5.53e-17 SMART
Pfam:DUF3371 381 507 4.8e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113339
AA Change: T229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108965
Gene: ENSMUSG00000035158
AA Change: T229M

DomainStartEndE-ValueType
coiled coil region 35 65 N/A INTRINSIC
HLH 292 345 5.53e-17 SMART
Pfam:DUF3371 372 498 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139462
Predicted Effect possibly damaging
Transcript: ENSMUST00000203884
AA Change: T254M

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145132
Gene: ENSMUSG00000035158
AA Change: T254M

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 2.2e-49 PFAM
HLH 311 364 2.3e-19 SMART
Pfam:DUF3371 391 516 1.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203938
AA Change: T91M

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144988
Gene: ENSMUSG00000035158
AA Change: T91M

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 7 60 2.2e-7 PFAM
HLH 148 201 2.3e-19 SMART
Pfam:DUF3371 228 353 9.2e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This transcription factor serves at a critical point between extracellular signaling and downstream targets in cell specification in early eye and neural crest development. Mutant alleles have been identified that generate distinct phenotypes. Some of these alleles are being used to model the human diseases Waardenburg syndrome IIa and Tietz syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect development of melanocytes, mast cells, osteoclasts and pigmented epithelium. Mutants variably display lack of pigment in coat and eye, microphthalmia, hearing loss, bone resorption anomalies, mast cell deficiency and lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,101,912 M131V possibly damaging Het
Abcc10 T C 17: 46,310,377 Y950C probably benign Het
Acadm A G 3: 153,941,943 C20R probably damaging Het
Agtpbp1 G T 13: 59,473,746 T984K probably damaging Het
Agxt2 C T 15: 10,377,422 T136I probably damaging Het
Ankrd36 C A 11: 5,628,941 N68K probably damaging Het
Ap3b2 T A 7: 81,493,592 D10V possibly damaging Het
Apcdd1 A T 18: 62,937,366 I235F probably damaging Het
Arhgap32 T A 9: 32,260,111 W1396R probably damaging Het
Ascc3 A G 10: 50,649,247 T513A probably benign Het
Aym1 C T 5: 113,357,541 L9F unknown Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Camk2a A T 18: 60,943,234 K95* probably null Het
Ccdc40 T C 11: 119,231,978 V202A probably benign Het
Cd200r3 T A 16: 44,953,682 D152E probably benign Het
Cd2bp2 C T 7: 127,194,815 D101N probably damaging Het
Cdh20 G A 1: 104,994,014 D679N probably damaging Het
Clpx C T 9: 65,299,952 T44I probably benign Het
Cnnm4 T G 1: 36,498,479 V541G probably damaging Het
Csmd1 T C 8: 16,199,860 I1035V possibly damaging Het
Ctsw T C 19: 5,467,119 S62G probably benign Het
Dlk2 T A 17: 46,301,697 Y109N probably damaging Het
Ebf3 C T 7: 137,206,226 V363M probably damaging Het
Farsb A G 1: 78,463,270 probably null Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gk5 C A 9: 96,140,610 F166L probably benign Het
Gm11271 G T 13: 21,381,139 noncoding transcript Het
Gm5294 C A 5: 138,820,095 Q6K probably damaging Het
Gnat2 T A 3: 108,100,135 Y290N probably damaging Het
H2-D1 A T 17: 35,263,937 I148F probably damaging Het
Hdac2 A G 10: 36,986,389 D83G probably null Het
Kdm5d T C Y: 921,501 W500R probably damaging Het
Kel A T 6: 41,688,862 F489I probably benign Het
Kmo C A 1: 175,637,908 A76E possibly damaging Het
Krt32 T C 11: 100,087,965 T88A probably benign Het
Lce3b A G 3: 92,933,687 T30A unknown Het
Lcn11 A G 2: 25,779,296 H155R possibly damaging Het
Lmln T A 16: 33,069,111 I129N possibly damaging Het
Meiob A G 17: 24,813,019 K3E probably benign Het
Muc16 T C 9: 18,655,359 I1955V unknown Het
Naip1 A G 13: 100,427,182 C492R probably damaging Het
Ncor2 C T 5: 125,055,846 A26T probably damaging Het
Ngfr T G 11: 95,578,057 D165A probably damaging Het
Nobox A T 6: 43,305,169 S323R probably damaging Het
Olfr616 T C 7: 103,565,139 I47V probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Olfr937 A G 9: 39,060,196 S157P probably benign Het
Pcdhb1 G T 18: 37,265,253 V86F possibly damaging Het
Pdk1 A G 2: 71,883,506 E165G probably benign Het
Peak1 C T 9: 56,259,283 V454I probably benign Het
Rad9b C T 5: 122,344,297 G125D probably damaging Het
S100a16 T C 3: 90,542,074 F19L probably damaging Het
Serpine2 T C 1: 79,810,671 K190E probably damaging Het
Slf1 A T 13: 77,126,680 M12K probably damaging Het
Tex101 T C 7: 24,668,313 T205A possibly damaging Het
Tssk5 T C 15: 76,373,716 E147G probably damaging Het
Ubr4 A G 4: 139,417,364 T1495A probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Wdr70 A T 15: 8,079,154 probably null Het
Zfp811 T A 17: 32,797,374 probably null Het
Zscan10 T A 17: 23,607,129 F88L probably damaging Het
Other mutations in Mitf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Mitf APN 6 98017931 missense possibly damaging 0.69
IGL01516:Mitf APN 6 98010390 splice site probably null
IGL01617:Mitf APN 6 97996428 missense probably benign 0.00
IGL01875:Mitf APN 6 98017895 missense probably benign 0.22
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0079:Mitf UTSW 6 97996440 missense probably benign 0.00
R0381:Mitf UTSW 6 97993143 missense probably damaging 1.00
R0494:Mitf UTSW 6 97994429 missense probably benign 0.00
R0633:Mitf UTSW 6 98003904 missense probably damaging 0.98
R0829:Mitf UTSW 6 98003908 missense possibly damaging 0.46
R1189:Mitf UTSW 6 98006125 missense possibly damaging 0.67
R1459:Mitf UTSW 6 98010467 missense probably damaging 1.00
R1766:Mitf UTSW 6 97941099 missense probably damaging 1.00
R1864:Mitf UTSW 6 98010422 missense probably damaging 1.00
R1891:Mitf UTSW 6 97941276 missense probably benign 0.00
R3934:Mitf UTSW 6 97993253 missense probably damaging 1.00
R3936:Mitf UTSW 6 97993253 missense probably damaging 1.00
R4323:Mitf UTSW 6 97991949 missense probably benign 0.12
R5052:Mitf UTSW 6 98010445 missense possibly damaging 0.91
R5097:Mitf UTSW 6 97996462 missense possibly damaging 0.63
R5297:Mitf UTSW 6 97994430 missense probably benign 0.09
R5646:Mitf UTSW 6 98013694 missense probably damaging 1.00
R6351:Mitf UTSW 6 98003912 missense possibly damaging 0.85
R6411:Mitf UTSW 6 98010472 critical splice donor site probably null
R7855:Mitf UTSW 6 97993196 missense probably damaging 1.00
R7904:Mitf UTSW 6 98013710 missense probably damaging 0.99
R7975:Mitf UTSW 6 98018029 missense probably benign 0.17
R8061:Mitf UTSW 6 97993298 missense probably damaging 0.98
Z1177:Mitf UTSW 6 98006121 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTGGGGAGAGAATACTTTCAC -3'
(R):5'- ACTCGAGCAAGCTTCTTAATTTCTG -3'

Sequencing Primer
(F):5'- CTGTTGCTTTAGGTAAGAAAGGACC -3'
(R):5'- GAGCAAGCTTCTTAATTTCTGATGTC -3'
Posted On2017-08-16