Incidental Mutation 'R6109:Naip1'
ID484739
Institutional Source Beutler Lab
Gene Symbol Naip1
Ensembl Gene ENSMUSG00000021640
Gene NameNLR family, apoptosis inhibitory protein 1
SynonymsBirc1a, D13Lsd1, Naip
MMRRC Submission 044259-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6109 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100407764-100452869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100427182 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 492 (C492R)
Ref Sequence ENSEMBL: ENSMUSP00000152583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221727] [ENSMUST00000221943] [ENSMUST00000222155]
Predicted Effect probably damaging
Transcript: ENSMUST00000022142
AA Change: C492R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: C492R

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.18e-20 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 7.82e-26 SMART
AAA 462 603 1.14e-2 SMART
low complexity region 908 919 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221727
Predicted Effect probably benign
Transcript: ENSMUST00000221943
Predicted Effect probably damaging
Transcript: ENSMUST00000222155
AA Change: C492R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,101,912 M131V possibly damaging Het
Abcc10 T C 17: 46,310,377 Y950C probably benign Het
Acadm A G 3: 153,941,943 C20R probably damaging Het
Agtpbp1 G T 13: 59,473,746 T984K probably damaging Het
Agxt2 C T 15: 10,377,422 T136I probably damaging Het
Ankrd36 C A 11: 5,628,941 N68K probably damaging Het
Ap3b2 T A 7: 81,493,592 D10V possibly damaging Het
Apcdd1 A T 18: 62,937,366 I235F probably damaging Het
Arhgap32 T A 9: 32,260,111 W1396R probably damaging Het
Ascc3 A G 10: 50,649,247 T513A probably benign Het
Aym1 C T 5: 113,357,541 L9F unknown Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Camk2a A T 18: 60,943,234 K95* probably null Het
Ccdc40 T C 11: 119,231,978 V202A probably benign Het
Cd200r3 T A 16: 44,953,682 D152E probably benign Het
Cd2bp2 C T 7: 127,194,815 D101N probably damaging Het
Cdh20 G A 1: 104,994,014 D679N probably damaging Het
Clpx C T 9: 65,299,952 T44I probably benign Het
Cnnm4 T G 1: 36,498,479 V541G probably damaging Het
Csmd1 T C 8: 16,199,860 I1035V possibly damaging Het
Ctsw T C 19: 5,467,119 S62G probably benign Het
Dlk2 T A 17: 46,301,697 Y109N probably damaging Het
Ebf3 C T 7: 137,206,226 V363M probably damaging Het
Farsb A G 1: 78,463,270 probably null Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gk5 C A 9: 96,140,610 F166L probably benign Het
Gm11271 G T 13: 21,381,139 noncoding transcript Het
Gm5294 C A 5: 138,820,095 Q6K probably damaging Het
Gnat2 T A 3: 108,100,135 Y290N probably damaging Het
H2-D1 A T 17: 35,263,937 I148F probably damaging Het
Hdac2 A G 10: 36,986,389 D83G probably null Het
Kdm5d T C Y: 921,501 W500R probably damaging Het
Kel A T 6: 41,688,862 F489I probably benign Het
Kmo C A 1: 175,637,908 A76E possibly damaging Het
Krt32 T C 11: 100,087,965 T88A probably benign Het
Lce3b A G 3: 92,933,687 T30A unknown Het
Lcn11 A G 2: 25,779,296 H155R possibly damaging Het
Lmln T A 16: 33,069,111 I129N possibly damaging Het
Meiob A G 17: 24,813,019 K3E probably benign Het
Mitf C T 6: 97,996,468 T229M probably damaging Het
Muc16 T C 9: 18,655,359 I1955V unknown Het
Ncor2 C T 5: 125,055,846 A26T probably damaging Het
Ngfr T G 11: 95,578,057 D165A probably damaging Het
Nobox A T 6: 43,305,169 S323R probably damaging Het
Olfr616 T C 7: 103,565,139 I47V probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Olfr937 A G 9: 39,060,196 S157P probably benign Het
Pcdhb1 G T 18: 37,265,253 V86F possibly damaging Het
Pdk1 A G 2: 71,883,506 E165G probably benign Het
Peak1 C T 9: 56,259,283 V454I probably benign Het
Rad9b C T 5: 122,344,297 G125D probably damaging Het
S100a16 T C 3: 90,542,074 F19L probably damaging Het
Serpine2 T C 1: 79,810,671 K190E probably damaging Het
Slf1 A T 13: 77,126,680 M12K probably damaging Het
Tex101 T C 7: 24,668,313 T205A possibly damaging Het
Tssk5 T C 15: 76,373,716 E147G probably damaging Het
Ubr4 A G 4: 139,417,364 T1495A probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Wdr70 A T 15: 8,079,154 probably null Het
Zfp811 T A 17: 32,797,374 probably null Het
Zscan10 T A 17: 23,607,129 F88L probably damaging Het
Other mutations in Naip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Naip1 APN 13 100443720 critical splice acceptor site probably null
IGL01145:Naip1 APN 13 100409121 missense probably benign 0.00
IGL01356:Naip1 APN 13 100423214 missense probably damaging 0.99
IGL01414:Naip1 APN 13 100409173 critical splice acceptor site probably null
IGL01505:Naip1 APN 13 100425933 missense probably damaging 1.00
IGL01573:Naip1 APN 13 100427382 missense probably benign 0.03
IGL01931:Naip1 APN 13 100409032 nonsense probably null
IGL02043:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02097:Naip1 APN 13 100425588 missense probably benign 0.03
IGL02331:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02627:Naip1 APN 13 100425648 missense possibly damaging 0.68
IGL02675:Naip1 APN 13 100409118 missense probably benign
IGL02801:Naip1 APN 13 100444368 missense probably damaging 1.00
IGL02851:Naip1 APN 13 100433262 missense probably damaging 1.00
IGL03038:Naip1 APN 13 100437333 nonsense probably null
IGL03399:Naip1 APN 13 100408918 missense probably damaging 1.00
FR4340:Naip1 UTSW 13 100423076 missense probably benign
FR4342:Naip1 UTSW 13 100425471 missense probably benign 0.00
R0051:Naip1 UTSW 13 100411001 missense probably damaging 0.96
R0095:Naip1 UTSW 13 100423083 missense probably benign 0.24
R0147:Naip1 UTSW 13 100426910 missense possibly damaging 0.67
R0375:Naip1 UTSW 13 100409148 missense probably benign 0.21
R0442:Naip1 UTSW 13 100444516 missense probably benign 0.00
R0455:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0491:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0614:Naip1 UTSW 13 100444200 missense probably benign 0.00
R0785:Naip1 UTSW 13 100423076 missense probably benign
R0785:Naip1 UTSW 13 100423085 missense probably benign 0.00
R0787:Naip1 UTSW 13 100426096 missense probably benign 0.22
R1081:Naip1 UTSW 13 100423070 missense probably benign 0.21
R1177:Naip1 UTSW 13 100427064 missense possibly damaging 0.91
R1476:Naip1 UTSW 13 100426870 missense probably benign 0.35
R1672:Naip1 UTSW 13 100423149 missense probably benign 0.00
R1809:Naip1 UTSW 13 100426239 missense probably benign
R2057:Naip1 UTSW 13 100425573 missense probably damaging 0.96
R2182:Naip1 UTSW 13 100413680 missense probably benign 0.01
R2395:Naip1 UTSW 13 100423106 missense possibly damaging 0.83
R2518:Naip1 UTSW 13 100423219 missense probably benign 0.00
R3033:Naip1 UTSW 13 100432458 missense probably benign 0.01
R3122:Naip1 UTSW 13 100408995 missense probably damaging 1.00
R3439:Naip1 UTSW 13 100423219 missense probably benign 0.00
R4167:Naip1 UTSW 13 100444286 missense probably benign 0.04
R4179:Naip1 UTSW 13 100426176 missense probably damaging 0.99
R4212:Naip1 UTSW 13 100426875 splice site probably null
R4639:Naip1 UTSW 13 100444283 missense probably benign 0.31
R4674:Naip1 UTSW 13 100444174 missense probably damaging 1.00
R4736:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4740:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4778:Naip1 UTSW 13 100426648 missense probably damaging 1.00
R4806:Naip1 UTSW 13 100425621 missense probably benign 0.00
R4855:Naip1 UTSW 13 100423220 splice site probably null
R5740:Naip1 UTSW 13 100432501 critical splice acceptor site probably null
R5797:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R5806:Naip1 UTSW 13 100444735 start codon destroyed probably null 1.00
R5895:Naip1 UTSW 13 100423128 missense probably benign 0.00
R5896:Naip1 UTSW 13 100423128 missense probably benign 0.00
R6023:Naip1 UTSW 13 100426186 missense probably benign 0.00
R6117:Naip1 UTSW 13 100444737 start codon destroyed probably damaging 0.99
R6133:Naip1 UTSW 13 100444643 missense probably benign 0.10
R6241:Naip1 UTSW 13 100425661 missense probably damaging 0.99
R6335:Naip1 UTSW 13 100426552 missense probably damaging 1.00
R6404:Naip1 UTSW 13 100423219 missense probably benign 0.00
R6475:Naip1 UTSW 13 100409088 missense probably damaging 1.00
R6508:Naip1 UTSW 13 100436465 missense probably damaging 1.00
R6580:Naip1 UTSW 13 100444649 missense probably damaging 0.99
R6600:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6600:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6603:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6603:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6633:Naip1 UTSW 13 100423076 missense probably benign
R6633:Naip1 UTSW 13 100423085 missense probably benign 0.00
R6720:Naip1 UTSW 13 100423077 missense probably benign 0.00
R6805:Naip1 UTSW 13 100427341 missense probably benign 0.04
R7043:Naip1 UTSW 13 100426914 missense probably damaging 1.00
R7615:Naip1 UTSW 13 100425776 missense probably benign 0.00
R7797:Naip1 UTSW 13 100444478 missense probably damaging 1.00
R7820:Naip1 UTSW 13 100423070 missense probably benign 0.21
R7842:Naip1 UTSW 13 100426998 missense probably damaging 1.00
R8117:Naip1 UTSW 13 100427001 missense possibly damaging 0.67
R8132:Naip1 UTSW 13 100437375 missense possibly damaging 0.84
R8177:Naip1 UTSW 13 100427403 missense probably benign 0.00
R8203:Naip1 UTSW 13 100425820 missense probably benign 0.02
R8283:Naip1 UTSW 13 100427187 missense probably damaging 1.00
R8319:Naip1 UTSW 13 100429213 missense probably benign 0.13
R8377:Naip1 UTSW 13 100425866 missense possibly damaging 0.53
RF007:Naip1 UTSW 13 100426134 missense probably benign 0.03
X0066:Naip1 UTSW 13 100437322 missense probably damaging 1.00
Y4335:Naip1 UTSW 13 100425522 missense probably benign 0.00
Y4336:Naip1 UTSW 13 100425522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACCTGGTGTTGTAACTG -3'
(R):5'- GCCACTTTTCGCCACATGAAC -3'

Sequencing Primer
(F):5'- AACTGCTGGATGATGCTGCTC -3'
(R):5'- AACTTGCCAGAAGTGTGCTC -3'
Posted On2017-08-16