Incidental Mutation 'R6110:Ptpn22'
ID484772
Institutional Source Beutler Lab
Gene Symbol Ptpn22
Ensembl Gene ENSMUSG00000027843
Gene Nameprotein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms70zpep, Ptpn8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103859795-103912247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103912015 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 795 (N795S)
Ref Sequence ENSEMBL: ENSMUSP00000029433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000051139] [ENSMUST00000068879] [ENSMUST00000146071]
PDB Structure
Solution structure of the SH3 domain from C-terminal Src Kinase complexed with a peptide from the tyrosine phosphatase PEP [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029433
AA Change: N795S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843
AA Change: N795S

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000051139
SMART Domains Protein: ENSMUSP00000058934
Gene: ENSMUSG00000044098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068879
SMART Domains Protein: ENSMUSP00000069246
Gene: ENSMUSG00000044098

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 131 156 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134373
Predicted Effect probably benign
Transcript: ENSMUST00000146071
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000151927
SMART Domains Protein: ENSMUSP00000115693
Gene: ENSMUSG00000044098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Ptpn22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Ptpn22 APN 3 103903374 missense probably benign 0.01
IGL01373:Ptpn22 APN 3 103886204 missense probably damaging 0.99
IGL01943:Ptpn22 APN 3 103886336 missense probably benign 0.02
IGL02092:Ptpn22 APN 3 103877321 missense probably damaging 1.00
IGL02431:Ptpn22 APN 3 103903397 missense probably benign 0.01
IGL02732:Ptpn22 APN 3 103886033 missense probably damaging 0.98
IGL02738:Ptpn22 APN 3 103874066 splice site probably benign
IGL03406:Ptpn22 APN 3 103912016 missense probably benign 0.14
R0490:Ptpn22 UTSW 3 103886179 missense probably damaging 1.00
R0494:Ptpn22 UTSW 3 103860455 missense probably damaging 1.00
R0626:Ptpn22 UTSW 3 103860405 start codon destroyed probably null 1.00
R0743:Ptpn22 UTSW 3 103902171 missense probably damaging 1.00
R1441:Ptpn22 UTSW 3 103874247 missense probably damaging 1.00
R1610:Ptpn22 UTSW 3 103902196 splice site probably null
R1698:Ptpn22 UTSW 3 103885798 missense probably benign 0.20
R1785:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1786:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1919:Ptpn22 UTSW 3 103876738 critical splice donor site probably null
R2045:Ptpn22 UTSW 3 103874021 missense possibly damaging 0.61
R3977:Ptpn22 UTSW 3 103873641 splice site probably benign
R4176:Ptpn22 UTSW 3 103886245 missense probably benign 0.00
R4478:Ptpn22 UTSW 3 103902064 intron probably benign
R5093:Ptpn22 UTSW 3 103882102 missense probably benign 0.39
R5579:Ptpn22 UTSW 3 103882139 splice site probably null
R6022:Ptpn22 UTSW 3 103886105 missense probably benign 0.00
R6387:Ptpn22 UTSW 3 103885386 missense probably benign 0.18
R7335:Ptpn22 UTSW 3 103886019 missense probably damaging 0.97
R7516:Ptpn22 UTSW 3 103885538 missense probably benign 0.16
R7523:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R7583:Ptpn22 UTSW 3 103902114 missense probably benign 0.11
R8129:Ptpn22 UTSW 3 103890284 critical splice donor site probably null
R8141:Ptpn22 UTSW 3 103886327 missense possibly damaging 0.67
Z1177:Ptpn22 UTSW 3 103885700 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CAGGCTACTATAACCAGGGTTC -3'
(R):5'- TTGCTGGAAGTTTGTCACATATTGC -3'

Sequencing Primer
(F):5'- ATGCAAGGCCCATAGTTTGATCC -3'
(R):5'- GGAAGTTTGTCACATATTGCTTTCC -3'
Posted On2017-08-16