Incidental Mutation 'R6110:Amy1'
ID 484774
Institutional Source Beutler Lab
Gene Symbol Amy1
Ensembl Gene ENSMUSG00000074264
Gene Name amylase 1, salivary
Synonyms Amy-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R6110 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 113555710-113606699 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 113561900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 309 (V309M)
Ref Sequence ENSEMBL: ENSMUSP00000102150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067980] [ENSMUST00000106540] [ENSMUST00000142505] [ENSMUST00000174147]
AlphaFold P00687
Predicted Effect probably damaging
Transcript: ENSMUST00000067980
AA Change: V309M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070368
Gene: ENSMUSG00000074264
AA Change: V309M

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106540
AA Change: V309M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102150
Gene: ENSMUSG00000074264
AA Change: V309M

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142505
SMART Domains Protein: ENSMUSP00000120493
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 36 271 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172885
Predicted Effect probably benign
Transcript: ENSMUST00000174147
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Amy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Amy1 APN 3 113556132 missense probably damaging 1.00
IGL00966:Amy1 APN 3 113556040 missense probably benign 0.00
IGL01153:Amy1 APN 3 113556075 missense possibly damaging 0.69
IGL02415:Amy1 APN 3 113563585 missense probably benign 0.27
IGL02555:Amy1 APN 3 113564892 missense probably benign 0.01
IGL02572:Amy1 APN 3 113565073 splice site probably benign
IGL03215:Amy1 APN 3 113556000 missense probably benign
R0196:Amy1 UTSW 3 113569421 missense probably benign
R0230:Amy1 UTSW 3 113558430 missense probably benign 0.02
R0586:Amy1 UTSW 3 113562769 unclassified probably benign
R1789:Amy1 UTSW 3 113558165 missense possibly damaging 0.56
R1823:Amy1 UTSW 3 113562727 missense probably null
R1922:Amy1 UTSW 3 113564895 missense probably damaging 0.97
R2080:Amy1 UTSW 3 113558094 missense probably benign 0.01
R3147:Amy1 UTSW 3 113570048 start gained probably benign
R3437:Amy1 UTSW 3 113556009 missense probably damaging 1.00
R4961:Amy1 UTSW 3 113561849 missense probably damaging 1.00
R4977:Amy1 UTSW 3 113569377 splice site probably null
R5304:Amy1 UTSW 3 113558364 missense probably damaging 1.00
R5500:Amy1 UTSW 3 113562722 missense probably damaging 1.00
R5503:Amy1 UTSW 3 113556060 missense probably benign 0.26
R5706:Amy1 UTSW 3 113556120 missense probably damaging 0.99
R5866:Amy1 UTSW 3 113561920 missense possibly damaging 0.93
R5956:Amy1 UTSW 3 113563662 missense probably benign 0.04
R6259:Amy1 UTSW 3 113569410 missense possibly damaging 0.73
R6278:Amy1 UTSW 3 113561690 missense probably damaging 1.00
R6429:Amy1 UTSW 3 113569509 missense probably damaging 1.00
R6893:Amy1 UTSW 3 113563632 missense probably benign 0.00
R7136:Amy1 UTSW 3 113563599 missense probably damaging 1.00
R7463:Amy1 UTSW 3 113569884 nonsense probably null
R9193:Amy1 UTSW 3 113562629 missense probably benign 0.22
Z1177:Amy1 UTSW 3 113558353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACAGCCATTTTATAGAGTCTG -3'
(R):5'- CCTGAGATCATCTACATTGCAATC -3'

Sequencing Primer
(F):5'- GAATAGCTTTACCTACCTAGC -3'
(R):5'- TGCAATCTTACATGAAATGTGGATG -3'
Posted On 2017-08-16