Incidental Mutation 'R0520:Acod1'
ID48478
Institutional Source Beutler Lab
Gene Symbol Acod1
Ensembl Gene ENSMUSG00000022126
Gene Nameaconitate decarboxylase 1
SynonymsIrg1
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0520 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103046977-103056573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103051516 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 154 (I154T)
Ref Sequence ENSEMBL: ENSMUSP00000022722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022722
AA Change: I154T

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022722
Gene: ENSMUSG00000022126
AA Change: I154T

DomainStartEndE-ValueType
Pfam:MmgE_PrpD 7 450 1.8e-125 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: LPS-stimulated bone marrow macrophages derived from homozygous null mice fail to produce itaconate and exhibit significantly decreased succinate accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Apaf1 A T 10: 91,079,989 H12Q probably damaging Het
Asic1 A T 15: 99,695,535 I291F probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Asxl3 A T 18: 22,522,986 D1351V probably damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Fggy T A 4: 95,601,103 L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
Krtap19-2 C T 16: 88,873,861 probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr871 G A 9: 20,212,495 V49I probably benign Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Plekhm1 T C 11: 103,394,944 I222V probably benign Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Acod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Acod1 APN 14 103051334 missense probably damaging 1.00
IGL01450:Acod1 APN 14 103051483 missense possibly damaging 0.77
IGL01624:Acod1 APN 14 103055233 missense probably benign 0.03
IGL03323:Acod1 APN 14 103055294 missense probably damaging 1.00
R0049:Acod1 UTSW 14 103055207 missense possibly damaging 0.94
R0049:Acod1 UTSW 14 103055207 missense possibly damaging 0.94
R0304:Acod1 UTSW 14 103054982 missense probably damaging 0.97
R0321:Acod1 UTSW 14 103055129 missense probably benign 0.13
R1467:Acod1 UTSW 14 103054567 missense probably benign 0.00
R1467:Acod1 UTSW 14 103054567 missense probably benign 0.00
R1541:Acod1 UTSW 14 103049333 missense probably damaging 0.98
R2511:Acod1 UTSW 14 103051339 missense probably damaging 1.00
R3856:Acod1 UTSW 14 103055446 missense possibly damaging 0.92
R4616:Acod1 UTSW 14 103055345 missense probably benign 0.10
R4671:Acod1 UTSW 14 103047072 missense probably benign 0.15
R5080:Acod1 UTSW 14 103049308 missense possibly damaging 0.83
R5206:Acod1 UTSW 14 103055295 missense possibly damaging 0.90
R5992:Acod1 UTSW 14 103055035 missense probably damaging 1.00
R7228:Acod1 UTSW 14 103049329 missense probably benign 0.04
R7585:Acod1 UTSW 14 103054741 nonsense probably null
R7762:Acod1 UTSW 14 103051340 missense probably damaging 1.00
R8337:Acod1 UTSW 14 103049344 missense possibly damaging 0.76
R8725:Acod1 UTSW 14 103049639 missense probably damaging 1.00
R8778:Acod1 UTSW 14 103055482 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGATGACACATGGCACCCTGC -3'
(R):5'- TCCCAAGAGAAGGTCTCAGGATCG -3'

Sequencing Primer
(F):5'- GCCACCCACCCTTCTGG -3'
(R):5'- AGGTCTCAGGATCGTTTCCAAATC -3'
Posted On2013-06-12