Incidental Mutation 'R6110:Vmn2r44'
ID484781
Institutional Source Beutler Lab
Gene Symbol Vmn2r44
Ensembl Gene ENSMUSG00000094098
Gene Namevomeronasal 2, receptor 44
SynonymsEG434113
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6110 (G1)
Quality Score203.009
Status Not validated
Chromosome7
Chromosomal Location8366502-8383354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8378006 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 296 (I296K)
Ref Sequence ENSEMBL: ENSMUSP00000132467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166499]
Predicted Effect probably damaging
Transcript: ENSMUST00000166499
AA Change: I296K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132467
Gene: ENSMUSG00000094098
AA Change: I296K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-34 PFAM
Pfam:NCD3G 512 565 3.8e-20 PFAM
Pfam:7tm_3 598 833 5.7e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Vmn2r44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Vmn2r44 APN 7 8380104 critical splice donor site probably null
IGL01723:Vmn2r44 APN 7 8377916 missense probably damaging 0.97
IGL01767:Vmn2r44 APN 7 8380238 missense probably benign 0.00
IGL02161:Vmn2r44 APN 7 8377815 missense possibly damaging 0.94
IGL02299:Vmn2r44 APN 7 8377816 missense probably benign
IGL02418:Vmn2r44 APN 7 8377865 missense probably damaging 1.00
IGL02829:Vmn2r44 APN 7 8377880 missense possibly damaging 0.94
IGL02851:Vmn2r44 APN 7 8383051 missense probably damaging 1.00
IGL03080:Vmn2r44 APN 7 8383245 utr 5 prime probably benign
R1471:Vmn2r44 UTSW 7 8377883 missense probably damaging 0.99
R1789:Vmn2r44 UTSW 7 8380123 missense possibly damaging 0.64
R1932:Vmn2r44 UTSW 7 8367982 missense probably benign 0.04
R2354:Vmn2r44 UTSW 7 8370640 missense probably damaging 0.99
R4009:Vmn2r44 UTSW 7 8377988 missense possibly damaging 0.82
R4130:Vmn2r44 UTSW 7 8367919 missense probably damaging 1.00
R4790:Vmn2r44 UTSW 7 8367950 missense probably damaging 1.00
R4854:Vmn2r44 UTSW 7 8380301 missense possibly damaging 0.94
R4887:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R4888:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R5484:Vmn2r44 UTSW 7 8380124 missense possibly damaging 0.69
R6357:Vmn2r44 UTSW 7 8370658 missense probably benign 0.01
R6526:Vmn2r44 UTSW 7 8378099 missense probably benign 0.01
R7083:Vmn2r44 UTSW 7 8378370 missense probably benign 0.44
R7087:Vmn2r44 UTSW 7 8378367 missense probably benign 0.02
R7115:Vmn2r44 UTSW 7 8367528 nonsense probably null
R7125:Vmn2r44 UTSW 7 8367942 missense probably damaging 1.00
R7258:Vmn2r44 UTSW 7 8377849 missense probably damaging 1.00
R7359:Vmn2r44 UTSW 7 8367539 missense probably benign 0.30
R7494:Vmn2r44 UTSW 7 8383123 nonsense probably null
R7766:Vmn2r44 UTSW 7 8368220 missense probably damaging 1.00
R7777:Vmn2r44 UTSW 7 8378315 missense possibly damaging 0.81
R8184:Vmn2r44 UTSW 7 8368228 nonsense probably null
R8674:Vmn2r44 UTSW 7 8377823 missense probably damaging 1.00
R8752:Vmn2r44 UTSW 7 8367806 missense probably damaging 1.00
R8897:Vmn2r44 UTSW 7 8378243 missense probably damaging 1.00
R8915:Vmn2r44 UTSW 7 8367651 missense probably damaging 1.00
Z1177:Vmn2r44 UTSW 7 8367977 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGCCAATCAAATGAGGCATCAG -3'
(R):5'- GCTTTGCCTTTGTGAAAATGATCTC -3'

Sequencing Primer
(F):5'- GAGGCATCAGATGAATTGTTCTTCAG -3'
(R):5'- GCCTTTGTGAAAATGATCTCTGTTG -3'
Posted On2017-08-16