Mutagenetix > Incidental Mutations

Incidental Mutation 'R6110:C2cd3'

484785

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6110 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100441076 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 462 (F462Y)

Ref Sequence

ENSEMBL: ENSMUSP00000113728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051777
AA Change: F1693Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: F1693Y

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098259
AA Change: F1693Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: F1693Y

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000119647
AA Change: F1315Y

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: F1315Y

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120196
AA Change: F462Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: F462Y

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184779

Meta Mutation Damage Score

0.1725

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.7%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7b	T	C	4: 56,740,224	E378G	probably damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Alkal2	G	A	12: 30,887,058	R90Q	probably damaging	Het
Amy1	C	T	3: 113,561,900	V309M	probably damaging	Het
Apob	T	C	12: 8,011,883	L3455P	probably damaging	Het
Ash1l	T	A	3: 88,985,129	H1438Q	probably damaging	Het
BC024139	A	G	15: 76,119,796	S757P	probably benign	Het
Btd	G	A	14: 31,641,108		probably benign	Het
C4bp	T	A	1: 130,639,072	K177*	probably null	Het
Cacna1h	G	T	17: 25,391,276	P752Q	probably benign	Het
Cd34	G	A	1: 194,949,569		probably null	Het
Clptm1	G	A	7: 19,633,806		probably benign	Het
Dip2c	T	C	13: 9,623,766	S1081P	probably damaging	Het
Dnm3	CAGCCTTCGTTGGGTG	C	1: 162,011,068		probably benign	Het
Efcab6	T	G	15: 83,879,634	M1166L	possibly damaging	Het
Fam151a	G	A	4: 106,748,198	V586M	probably damaging	Het
Fap	T	G	2: 62,554,770	Y54S	possibly damaging	Het
Gm17727	A	T	9: 35,777,146	S48T	possibly damaging	Het
Grhl1	A	G	12: 24,580,747		probably null	Het
Hcrtr2	T	C	9: 76,259,782	Y91C	probably damaging	Het
Kat6b	C	T	14: 21,670,487	R1745C	probably damaging	Het
Kdm5a	T	C	6: 120,412,306	L898P	probably damaging	Het
Lipo5	T	C	19: 33,467,917	Q84R	unknown	Het
Mfn1	G	A	3: 32,563,024	M18I	probably benign	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Mtfmt	T	C	9: 65,447,304		probably null	Het
Nsun2	C	G	13: 69,627,648	Q404E	probably benign	Het
Odf3	G	T	7: 140,848,641	R73L	possibly damaging	Het
Olfr1052	T	A	2: 86,298,675	N286K	probably damaging	Het
Olfr1487	C	T	19: 13,619,885	A241V	probably benign	Het
Olfr346	T	C	2: 36,688,547	S182P	probably benign	Het
Olfr495	G	T	7: 108,395,828	S236I	possibly damaging	Het
Olfr520	C	T	7: 99,735,170	S9L	possibly damaging	Het
Olfr646	A	G	7: 104,106,572	M98V	probably damaging	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Parp9	A	G	16: 35,953,626	I90V	possibly damaging	Het
Pax2	T	A	19: 44,790,736	S183T	probably damaging	Het
Pcdha11	T	C	18: 37,011,456	L200P	probably damaging	Het
Pcdhb4	T	C	18: 37,308,429	V264A	possibly damaging	Het
Plch1	G	T	3: 63,698,858	N1199K	possibly damaging	Het
Ptpn22	A	G	3: 103,912,015	N795S	probably damaging	Het
Qars	T	C	9: 108,508,098	S6P	probably benign	Het
Sema3a	T	C	5: 13,581,001	Y502H	probably damaging	Het
Sema4f	A	G	6: 82,937,104	I91T	probably damaging	Het
Setx	T	G	2: 29,140,290	I247S	probably damaging	Het
Slc9c1	T	C	16: 45,575,368	L594P	probably damaging	Het
Tnfrsf19	A	T	14: 60,971,139	M311K	probably benign	Het
Ttc30b	T	C	2: 75,937,800	Y203C	probably damaging	Het
Tubgcp4	T	C	2: 121,194,108	I588T	probably benign	Het
Tyro3	T	C	2: 119,812,823	V655A	probably damaging	Het
Uba7	T	A	9: 107,978,939	D504E	probably benign	Het
Vav3	C	T	3: 109,664,365	T201M	probably damaging	Het
Vldlr	A	G	19: 27,238,077	E117G	possibly damaging	Het
Vmn2r44	A	T	7: 8,378,006	I296K	probably damaging	Het
Vmn2r80	T	A	10: 79,182,003	C521S	probably damaging	Het
Wnk1	A	T	6: 119,972,997		probably benign	Het
Xpo1	T	C	11: 23,287,434	S766P	probably damaging	Het
Zcchc4	A	G	5: 52,796,144	N165S	possibly damaging	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0124:C2cd3	UTSW	7	100469518	missense	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100407025	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4705:C2cd3	UTSW	7	100395188	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100459842	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100418540	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100451619	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100418504	missense
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- ATGCCTCTCTGGAGTCTAAGGAAC -3'
(R):5'- ACAATTGGAAAGGCTCTAGTCC -3'

Sequencing Primer
(F):5'- AGGAACTGTTTTCTTGCTGCAAAG -3'
(R):5'- TCCTCTACCAGACACCATG -3'

Posted On

2017-08-16