Incidental Mutation 'R6110:C2cd3'
ID484785
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100441076 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 462 (F462Y)
Ref Sequence ENSEMBL: ENSMUSP00000113728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: F1693Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: F1693Y

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: F1693Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: F1693Y

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119647
AA Change: F1315Y
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: F1315Y

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120196
AA Change: F462Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: F462Y

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184779
Meta Mutation Damage Score 0.1725 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
R7493:C2cd3 UTSW 7 100427226 missense
R7567:C2cd3 UTSW 7 100430815 missense
R7573:C2cd3 UTSW 7 100419707 missense
R7869:C2cd3 UTSW 7 100469491 missense probably damaging 0.99
R7999:C2cd3 UTSW 7 100459889 critical splice donor site probably null
R8134:C2cd3 UTSW 7 100418504 missense
R8369:C2cd3 UTSW 7 100395258 missense probably benign 0.03
R8372:C2cd3 UTSW 7 100455280 nonsense probably null
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATGCCTCTCTGGAGTCTAAGGAAC -3'
(R):5'- ACAATTGGAAAGGCTCTAGTCC -3'

Sequencing Primer
(F):5'- AGGAACTGTTTTCTTGCTGCAAAG -3'
(R):5'- TCCTCTACCAGACACCATG -3'
Posted On2017-08-16