Incidental Mutation 'R6110:Odf3'
ID484788
Institutional Source Beutler Lab
Gene Symbol Odf3
Ensembl Gene ENSMUSG00000025482
Gene Nameouter dense fiber of sperm tails 3
Synonyms1700011O04Rik, SHIPPO1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140847805-140851018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 140848641 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 73 (R73L)
Ref Sequence ENSEMBL: ENSMUSP00000101664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026555] [ENSMUST00000026557] [ENSMUST00000035300] [ENSMUST00000106049] [ENSMUST00000209690]
Predicted Effect probably benign
Transcript: ENSMUST00000026555
AA Change: R47L

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026555
Gene: ENSMUSG00000025482
AA Change: R47L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 25 59 3.8e-3 PFAM
Pfam:SHIPPO-rpt 65 95 7.8e-2 PFAM
Pfam:SHIPPO-rpt 100 131 1.2e-7 PFAM
Pfam:SHIPPO-rpt 136 170 3.9e-4 PFAM
Pfam:SHIPPO-rpt 179 209 3e-4 PFAM
Pfam:SHIPPO-rpt 215 245 9.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035300
SMART Domains Protein: ENSMUSP00000048722
Gene: ENSMUSG00000038801

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
UTG 30 91 1.66e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106049
AA Change: R73L

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101664
Gene: ENSMUSG00000025482
AA Change: R73L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 126 157 9.4e-6 PFAM
Pfam:SHIPPO-rpt 162 196 1e-3 PFAM
Pfam:SHIPPO-rpt 241 271 7.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190581
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Meta Mutation Damage Score 0.4168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ODF3 is a component of sperm flagella outer dense fibers, which add stiffness, elastic recoil, and protection against shearing forces during sperm movement.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Odf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0051:Odf3 UTSW 7 140850221 unclassified probably benign
R0547:Odf3 UTSW 7 140848815 splice site probably null
R0981:Odf3 UTSW 7 140848295 missense probably benign 0.00
R1221:Odf3 UTSW 7 140848383 missense probably damaging 1.00
R2849:Odf3 UTSW 7 140849269 missense probably benign 0.00
R4833:Odf3 UTSW 7 140848278 start codon destroyed probably null
R4854:Odf3 UTSW 7 140849462 missense probably damaging 1.00
R4896:Odf3 UTSW 7 140848485 intron probably benign
R5109:Odf3 UTSW 7 140849548 missense probably benign 0.11
R6354:Odf3 UTSW 7 140850614 splice site probably null
R6441:Odf3 UTSW 7 140849248 missense probably damaging 1.00
R6516:Odf3 UTSW 7 140848805 missense probably damaging 0.99
R6672:Odf3 UTSW 7 140848427 missense probably benign 0.27
R7086:Odf3 UTSW 7 140849489 missense probably benign
R7820:Odf3 UTSW 7 140849263 missense probably benign 0.44
R8069:Odf3 UTSW 7 140850302 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACCACGGGTAAGATTGCCTAAG -3'
(R):5'- TGGACATGCATATTAGGGCCC -3'

Sequencing Primer
(F):5'- AATCCTTGACTCCCATCG -3'
(R):5'- ATGCATATTAGGGCCCGGAGC -3'
Posted On2017-08-16