Incidental Mutation 'R6110:Gm17727'
ID484789
Institutional Source Beutler Lab
Gene Symbol Gm17727
Ensembl Gene ENSMUSG00000090738
Gene Namepredicted gene, 17727
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location35776524-35778109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35777146 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 48 (S48T)
Ref Sequence ENSEMBL: ENSMUSP00000129553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171898] [ENSMUST00000184431]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171898
AA Change: S48T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129553
Gene: ENSMUSG00000090738
AA Change: S48T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184431
SMART Domains Protein: ENSMUSP00000139380
Gene: ENSMUSG00000098847

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Gm17727
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Gm17727 APN 9 35776748 missense possibly damaging 0.73
IGL02044:Gm17727 APN 9 35776663 missense probably benign 0.19
IGL02352:Gm17727 APN 9 35777884 start codon destroyed probably null 0.04
IGL02359:Gm17727 APN 9 35777884 start codon destroyed probably null 0.04
R0827:Gm17727 UTSW 9 35777851 missense probably damaging 0.97
R1382:Gm17727 UTSW 9 35778094 start gained probably benign
R1591:Gm17727 UTSW 9 35776656 missense probably damaging 0.99
R1794:Gm17727 UTSW 9 35777122 missense probably benign 0.01
R5419:Gm17727 UTSW 9 35778111 unclassified probably null
R6379:Gm17727 UTSW 9 35778085 start gained probably benign
R6614:Gm17727 UTSW 9 35777125 missense probably damaging 0.99
R7698:Gm17727 UTSW 9 35777176 missense probably benign 0.27
R7833:Gm17727 UTSW 9 35777110 missense probably damaging 1.00
R7916:Gm17727 UTSW 9 35777110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAACTGTGACTGCTCCC -3'
(R):5'- CTACCTGAAACATATCTCTGTAAGGC -3'

Sequencing Primer
(F):5'- AAACTGTGACTGCTCCCTCTCAG -3'
(R):5'- GCAAAACCTTAATGAAGTCAAGAAGC -3'
Posted On2017-08-16