Incidental Mutation 'R6110:BC024139'
ID484807
Institutional Source Beutler Lab
Gene Symbol BC024139
Ensembl Gene ENSMUSG00000044361
Gene NamecDNA sequence BC024139
Synonyms6230424I18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76119517-76126596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76119796 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 757 (S757P)
Ref Sequence ENSEMBL: ENSMUSP00000053305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054022] [ENSMUST00000089654] [ENSMUST00000146157] [ENSMUST00000226781]
Predicted Effect probably benign
Transcript: ENSMUST00000054022
AA Change: S757P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053305
Gene: ENSMUSG00000044361
AA Change: S757P

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 672 701 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089654
SMART Domains Protein: ENSMUSP00000087082
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 671 703 3.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126892
Predicted Effect probably benign
Transcript: ENSMUST00000146157
SMART Domains Protein: ENSMUSP00000117783
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226663
Predicted Effect probably benign
Transcript: ENSMUST00000226781
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in BC024139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:BC024139 APN 15 76125100 missense probably benign 0.06
IGL01684:BC024139 APN 15 76124685 missense probably damaging 1.00
IGL01780:BC024139 APN 15 76121143 missense probably benign 0.01
IGL03084:BC024139 APN 15 76119807 missense probably benign 0.00
IGL03242:BC024139 APN 15 76120320 missense probably benign 0.32
IGL03386:BC024139 APN 15 76121745 missense probably benign 0.18
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0153:BC024139 UTSW 15 76121747 missense probably damaging 0.96
R0789:BC024139 UTSW 15 76121083 missense possibly damaging 0.51
R1158:BC024139 UTSW 15 76120342 unclassified probably benign
R1515:BC024139 UTSW 15 76124326 missense possibly damaging 0.83
R1840:BC024139 UTSW 15 76120642 missense probably benign
R1845:BC024139 UTSW 15 76125261 nonsense probably null
R2159:BC024139 UTSW 15 76121488 missense probably damaging 0.96
R2264:BC024139 UTSW 15 76125917 missense probably damaging 1.00
R2680:BC024139 UTSW 15 76121739 missense probably damaging 0.98
R2697:BC024139 UTSW 15 76120193 unclassified probably benign
R4113:BC024139 UTSW 15 76121627 missense probably benign 0.35
R4630:BC024139 UTSW 15 76125094 missense probably benign 0.23
R4825:BC024139 UTSW 15 76120317 missense possibly damaging 0.84
R4865:BC024139 UTSW 15 76126066 missense possibly damaging 0.56
R5208:BC024139 UTSW 15 76124665 missense probably benign 0.03
R5369:BC024139 UTSW 15 76120222 missense probably benign 0.02
R5371:BC024139 UTSW 15 76120686 makesense probably null
R5897:BC024139 UTSW 15 76126139 missense possibly damaging 0.84
R6374:BC024139 UTSW 15 76120457 critical splice donor site probably null
R6823:BC024139 UTSW 15 76119746 makesense probably null
R6915:BC024139 UTSW 15 76120021 missense probably benign
R7075:BC024139 UTSW 15 76124399 missense probably benign 0.06
R7669:BC024139 UTSW 15 76120568 missense possibly damaging 0.93
X0066:BC024139 UTSW 15 76124002 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTTTATTGCTGAGAGTGAGAGAC -3'
(R):5'- ATGCTAGGTCCTCCTGATGC -3'

Sequencing Primer
(F):5'- GGTGCACGCCTTTAATCCCAG -3'
(R):5'- AGGTCCTCCTGATGCTAGGTTC -3'
Posted On2017-08-16