Mutagenetix > Incidental Mutation

Incidental Mutation 'R6111:Ttll4'

484819

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

044260-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R6111 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 74697539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 1141 (K1141M)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678]

AlphaFold

Q80UG8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042125
AA Change: K1141M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: K1141M

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000113678
AA Change: K1077M

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: K1077M

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128891

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143790

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145132

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (57/58)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	T	C	14: 32,806,798	I40T	possibly damaging	Het
2210408I21Rik	A	G	13: 77,327,902	E1110G	possibly damaging	Het
Abcd4	G	A	12: 84,615,114	T79I	probably damaging	Het
Acd	A	G	8: 105,698,287	M407T	probably benign	Het
Adcy2	T	A	13: 68,729,241	H460L	probably damaging	Het
Arntl2	T	C	6: 146,820,599	F223L	probably benign	Het
Atad2	G	A	15: 58,108,091	H752Y	probably benign	Het
Camsap2	A	G	1: 136,281,298	S819P	probably benign	Het
Col24a1	C	A	3: 145,314,054	T62K	probably damaging	Het
Cpne6	G	A	14: 55,514,634	V283M	probably benign	Het
D630003M21Rik	A	G	2: 158,213,448	S590P	probably damaging	Het
Daam1	T	A	12: 71,942,264	M146K	unknown	Het
Dclk2	A	G	3: 86,805,661	Y495H	probably benign	Het
Ddx4	A	T	13: 112,621,232	C330*	probably null	Het
Dlec1	T	C	9: 119,102,624	L37P	possibly damaging	Het
Dock2	G	A	11: 34,708,787	P322S	probably damaging	Het
Espl1	A	G	15: 102,299,888	E443G	probably damaging	Het
Eya4	T	A	10: 23,140,055	D338V	possibly damaging	Het
Fcmr	A	G	1: 130,877,829	I267V	probably damaging	Het
Gfra3	T	A	18: 34,690,874	H349L	probably damaging	Het
Gm25747	A	G	12: 113,429,083		probably benign	Het
Gria4	G	A	9: 4,502,430	R368C	probably damaging	Het
H2-Q5	A	T	17: 35,394,909	I145F	possibly damaging	Het
Hace1	A	T	10: 45,589,510	K54I	possibly damaging	Het
Ift122	T	A	6: 115,875,286	I79N	probably damaging	Het
Ino80b	A	G	6: 83,124,366	V121A	probably damaging	Het
Kcnq1	A	G	7: 143,107,737	T63A	probably benign	Het
Map4k4	C	A	1: 40,011,662	Q762K	probably benign	Het
Mios	G	A	6: 8,214,836	A11T	probably benign	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Notch2	T	C	3: 98,146,293	S2091P	probably benign	Het
Nudt19	T	A	7: 35,555,527	D93V	probably benign	Het
Olfr875	T	C	9: 37,772,932	I91T	probably damaging	Het
Osbpl2	A	G	2: 180,150,201	T233A	probably benign	Het
P3h1	C	T	4: 119,241,132	R369*	probably null	Het
Pcdhb3	A	T	18: 37,302,189	I403L	probably benign	Het
Pigo	T	C	4: 43,019,724	D935G	probably benign	Het
Plpp1	A	G	13: 112,866,917	H224R	probably damaging	Het
Rai1	T	A	11: 60,187,906	M932K	probably damaging	Het
Rexo2	A	T	9: 48,473,112	F122L	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Sdc3	A	G	4: 130,818,842	T77A	unknown	Het
Skint5	T	C	4: 113,705,648	T786A	unknown	Het
Smok3c	C	A	5: 138,065,103	P284Q	probably damaging	Het
Spg11	A	G	2: 122,093,482	V786A	probably damaging	Het
Tnfrsf10b	T	A	14: 69,782,558	C380S	possibly damaging	Het
Tsen54	T	C	11: 115,820,130	V176A	possibly damaging	Het
Ttpa	A	T	4: 20,014,772	I116F	probably damaging	Het
Tubgcp6	T	C	15: 89,100,920	D1655G	possibly damaging	Het
Usp38	A	G	8: 81,013,922	V172A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Wdr72	T	C	9: 74,210,325	M773T	probably benign	Het
Xirp2	T	A	2: 67,511,817	H1467Q	possibly damaging	Het
Zdhhc8	G	T	16: 18,224,898	S479R	probably damaging	Het
Zfp423	A	G	8: 87,782,687	V322A	probably damaging	Het
Zfp72	T	G	13: 74,372,385	E191D	probably benign	Het
Zfp933	T	C	4: 147,828,760	T14A	probably damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85
R9701:Ttll4	UTSW	1	74681323	missense	probably benign	0.07
R9802:Ttll4	UTSW	1	74681323	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- CCCAGATCATGACAGTAAGAGG -3'
(R):5'- TCCCTTGAGGTAGCTGAGTG -3'

Sequencing Primer
(F):5'- AGTGTCAGAATCTGCAGCC -3'
(R):5'- CTGAGTGCTCCTGTGCAG -3'

Posted On

2017-08-16