Incidental Mutation 'R6111:Osbpl2'
ID484825
Institutional Source Beutler Lab
Gene Symbol Osbpl2
Ensembl Gene ENSMUSG00000039050
Gene Nameoxysterol binding protein-like 2
SynonymsORP-2, C130070J12Rik
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180119306-180162680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180150201 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 233 (T233A)
Ref Sequence ENSEMBL: ENSMUSP00000046538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040668]
Predicted Effect probably benign
Transcript: ENSMUST00000040668
AA Change: T233A

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046538
Gene: ENSMUSG00000039050
AA Change: T233A

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 75 474 8.4e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142376
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although the encoded protein contains only the sterol-binding domain. In vitro studies have shown that the encoded protein can bind strongly to phosphatic acid and weakly to phosphatidylinositol 3-phosphate, but cannot bind to 25-hydroxycholesterol. The protein associates with the Golgi apparatus. Transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Osbpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Osbpl2 APN 2 180150258 missense possibly damaging 0.60
IGL00824:Osbpl2 APN 2 180150267 missense probably benign 0.08
IGL01385:Osbpl2 APN 2 180137080 missense probably benign 0.10
IGL01449:Osbpl2 APN 2 180145194 splice site probably benign
R0735:Osbpl2 UTSW 2 180150290 splice site probably benign
R1315:Osbpl2 UTSW 2 180148602 missense probably damaging 0.98
R1583:Osbpl2 UTSW 2 180148463 missense probably damaging 0.99
R2023:Osbpl2 UTSW 2 180150176 splice site probably null
R2276:Osbpl2 UTSW 2 180148526 missense possibly damaging 0.96
R3737:Osbpl2 UTSW 2 180161560 missense probably damaging 1.00
R3739:Osbpl2 UTSW 2 180161560 missense probably damaging 1.00
R4035:Osbpl2 UTSW 2 180161560 missense probably damaging 1.00
R7324:Osbpl2 UTSW 2 180150201 missense probably benign 0.38
R7400:Osbpl2 UTSW 2 180153321 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTTGGCATTTAGGTAGAAAGC -3'
(R):5'- TGGCCTGTCTTCCCATAGAC -3'

Sequencing Primer
(F):5'- AGGTAGAAAGCTTTGTTGATGCTAC -3'
(R):5'- ATAGACAGCCTGGCCTGTCATC -3'
Posted On2017-08-16