Incidental Mutation 'R6111:Col24a1'
ID 484828
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 044260-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6111 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 145019815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 62 (T62K)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect probably damaging
Transcript: ENSMUST00000029848
AA Change: T62K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: T62K

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,476,021 (GRCm39) E1110G possibly damaging Het
Abcd4 G A 12: 84,661,888 (GRCm39) T79I probably damaging Het
Acd A G 8: 106,424,919 (GRCm39) M407T probably benign Het
Adcy2 T A 13: 68,877,360 (GRCm39) H460L probably damaging Het
Atad2 G A 15: 57,971,487 (GRCm39) H752Y probably benign Het
Bmal2 T C 6: 146,722,097 (GRCm39) F223L probably benign Het
Camsap2 A G 1: 136,209,036 (GRCm39) S819P probably benign Het
Cpne6 G A 14: 55,752,091 (GRCm39) V283M probably benign Het
D630003M21Rik A G 2: 158,055,368 (GRCm39) S590P probably damaging Het
Daam1 T A 12: 71,989,038 (GRCm39) M146K unknown Het
Dclk2 A G 3: 86,712,968 (GRCm39) Y495H probably benign Het
Ddx4 A T 13: 112,757,766 (GRCm39) C330* probably null Het
Dlec1 T C 9: 118,931,692 (GRCm39) L37P possibly damaging Het
Dock2 G A 11: 34,599,614 (GRCm39) P322S probably damaging Het
Espl1 A G 15: 102,208,323 (GRCm39) E443G probably damaging Het
Eya4 T A 10: 23,015,953 (GRCm39) D338V possibly damaging Het
Fcmr A G 1: 130,805,566 (GRCm39) I267V probably damaging Het
Gfra3 T A 18: 34,823,927 (GRCm39) H349L probably damaging Het
Gm25747 A G 12: 113,392,703 (GRCm39) probably benign Het
Gria4 G A 9: 4,502,430 (GRCm39) R368C probably damaging Het
H2-Q5 A T 17: 35,613,885 (GRCm39) I145F possibly damaging Het
Hace1 A T 10: 45,465,606 (GRCm39) K54I possibly damaging Het
Ift122 T A 6: 115,852,247 (GRCm39) I79N probably damaging Het
Ino80b A G 6: 83,101,347 (GRCm39) V121A probably damaging Het
Kcnq1 A G 7: 142,661,474 (GRCm39) T63A probably benign Het
Map4k4 C A 1: 40,050,822 (GRCm39) Q762K probably benign Het
Mios G A 6: 8,214,836 (GRCm39) A11T probably benign Het
Nfatc1 A G 18: 80,741,125 (GRCm39) S278P probably damaging Het
Notch2 T C 3: 98,053,609 (GRCm39) S2091P probably benign Het
Nudt19 T A 7: 35,254,952 (GRCm39) D93V probably benign Het
Or8b12b T C 9: 37,684,228 (GRCm39) I91T probably damaging Het
Osbpl2 A G 2: 179,791,994 (GRCm39) T233A probably benign Het
P3h1 C T 4: 119,098,329 (GRCm39) R369* probably null Het
Pcdhb3 A T 18: 37,435,242 (GRCm39) I403L probably benign Het
Pigo T C 4: 43,019,724 (GRCm39) D935G probably benign Het
Plpp1 A G 13: 113,003,451 (GRCm39) H224R probably damaging Het
Rai1 T A 11: 60,078,732 (GRCm39) M932K probably damaging Het
Rexo2 A T 9: 48,384,412 (GRCm39) F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Sdc3 A G 4: 130,546,153 (GRCm39) T77A unknown Het
Skint5 T C 4: 113,562,845 (GRCm39) T786A unknown Het
Smok3c C A 5: 138,063,365 (GRCm39) P284Q probably damaging Het
Spg11 A G 2: 121,923,963 (GRCm39) V786A probably damaging Het
Tmem273 T C 14: 32,528,755 (GRCm39) I40T possibly damaging Het
Tnfrsf10b T A 14: 70,020,007 (GRCm39) C380S possibly damaging Het
Tsen54 T C 11: 115,710,956 (GRCm39) V176A possibly damaging Het
Ttll4 A T 1: 74,736,698 (GRCm39) K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 (GRCm39) I116F probably damaging Het
Tubgcp6 T C 15: 88,985,123 (GRCm39) D1655G possibly damaging Het
Usp38 A G 8: 81,740,551 (GRCm39) V172A probably damaging Het
Vmn2r73 A G 7: 85,520,997 (GRCm39) S324P probably benign Het
Wdr72 T C 9: 74,117,607 (GRCm39) M773T probably benign Het
Xirp2 T A 2: 67,342,161 (GRCm39) H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,042,762 (GRCm39) S479R probably damaging Het
Zfp423 A G 8: 88,509,315 (GRCm39) V322A probably damaging Het
Zfp87 T G 13: 74,520,504 (GRCm39) E191D probably benign Het
Zfp933 T C 4: 147,913,217 (GRCm39) T14A probably damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATGGGTAGAACATGCTTATATC -3'
(R):5'- CGCCAAACTGCAGTCTGTTG -3'

Sequencing Primer
(F):5'- TGGGTAGAACATGCTTATATCAATTG -3'
(R):5'- GCTGAAGAGAAATGCATTGTTCAC -3'
Posted On 2017-08-16