Incidental Mutation 'R0520:Asic1'
ID48483
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R0520 (G1)
Quality Score208
Status Validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99695535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 291 (I291F)
Ref Sequence ENSEMBL: ENSMUSP00000154379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000228185]
Predicted Effect probably damaging
Transcript: ENSMUST00000023758
AA Change: I258F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: I258F

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228012
Predicted Effect probably damaging
Transcript: ENSMUST00000228185
AA Change: I291F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228610
Meta Mutation Damage Score 0.2680 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acod1 T C 14: 103,051,516 I154T possibly damaging Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Apaf1 A T 10: 91,079,989 H12Q probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Asxl3 A T 18: 22,522,986 D1351V probably damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Fggy T A 4: 95,601,103 L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
Krtap19-2 C T 16: 88,873,861 probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr871 G A 9: 20,212,495 V49I probably benign Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Plekhm1 T C 11: 103,394,944 I222V probably benign Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0243:Asic1 UTSW 15 99698617 unclassified probably benign
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R2895:Asic1 UTSW 15 99696602 missense probably benign 0.22
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R3848:Asic1 UTSW 15 99672933 missense probably benign 0.01
R5115:Asic1 UTSW 15 99672052 missense probably damaging 0.97
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R6383:Asic1 UTSW 15 99698880 missense probably damaging 0.96
R7133:Asic1 UTSW 15 99672087 missense probably damaging 1.00
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8012:Asic1 UTSW 15 99696651 missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTATTACCAGGGAGGGAGGTGT -3'
(R):5'- TCACCCACCACTGTGAGTGTGT -3'

Sequencing Primer
(F):5'- GTGTGATGCCCCAGGTTC -3'
(R):5'- tgtgtgtgtttgtgcccc -3'
Posted On2013-06-12