Incidental Mutation 'R6111:P3h1'
ID484832
Institutional Source Beutler Lab
Gene Symbol P3h1
Ensembl Gene ENSMUSG00000028641
Gene Nameprolyl 3-hydroxylase 1
SynonymsLepre1, Gros1, 2410024C15Rik
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location119232915-119248975 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 119241132 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 369 (R369*)
Ref Sequence ENSEMBL: ENSMUSP00000112504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278]
Predicted Effect probably null
Transcript: ENSMUST00000030393
AA Change: R369*
SMART Domains Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: R369*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.49e-12 PROSPERO
internal_repeat_1 294 369 2.49e-12 PROSPERO
Blast:P4Hc 419 462 2e-14 BLAST
P4Hc 479 687 5.96e-53 SMART
low complexity region 714 725 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081606
AA Change: R190*
SMART Domains Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: R190*

DomainStartEndE-ValueType
SCOP:d1hxia_ 80 195 4e-5 SMART
Blast:P4Hc 125 206 2e-11 BLAST
Blast:P4Hc 233 276 1e-14 BLAST
P4Hc 293 501 5.96e-53 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102662
AA Change: R369*
SMART Domains Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: R369*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 1.9e-12 PROSPERO
internal_repeat_1 294 369 1.9e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121111
AA Change: R369*
SMART Domains Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: R369*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.32e-12 PROSPERO
internal_repeat_1 294 369 2.32e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131875
Predicted Effect probably benign
Transcript: ENSMUST00000136278
SMART Domains Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 198 6.76e-13 PROSPERO
internal_repeat_1 294 356 6.76e-13 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153940
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in P3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01623:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01645:P3h1 APN 4 119236783 missense probably damaging 1.00
IGL02140:P3h1 APN 4 119237865 missense probably damaging 1.00
IGL02415:P3h1 APN 4 119247955 missense probably benign
IGL02543:P3h1 APN 4 119237856 splice site probably benign
IGL02870:P3h1 APN 4 119247571 missense probably damaging 1.00
IGL02972:P3h1 APN 4 119247960 missense possibly damaging 0.75
IGL03067:P3h1 APN 4 119235280 missense probably damaging 0.99
IGL03077:P3h1 APN 4 119236786 missense probably damaging 1.00
woohoo UTSW 4 119241132 nonsense probably null
R0194:P3h1 UTSW 4 119237952 missense probably damaging 1.00
R0523:P3h1 UTSW 4 119241530 missense probably benign 0.32
R0734:P3h1 UTSW 4 119238688 missense probably damaging 1.00
R0944:P3h1 UTSW 4 119238759 missense probably benign 0.00
R1018:P3h1 UTSW 4 119237907 missense probably damaging 0.99
R1978:P3h1 UTSW 4 119247976 missense probably null 0.00
R2697:P3h1 UTSW 4 119247180 missense probably damaging 1.00
R5668:P3h1 UTSW 4 119244046 missense possibly damaging 0.89
R5750:P3h1 UTSW 4 119238666 missense probably damaging 0.96
R5965:P3h1 UTSW 4 119248227 missense probably benign 0.00
R5987:P3h1 UTSW 4 119246665 missense probably damaging 1.00
R6786:P3h1 UTSW 4 119237954 missense possibly damaging 0.65
R7142:P3h1 UTSW 4 119247161 missense probably benign 0.00
R8068:P3h1 UTSW 4 119236862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTTGAGCATAGAGGGGAG -3'
(R):5'- TTTTAATGGCTCAGGACCGC -3'

Sequencing Primer
(F):5'- AGACCTTTGGCCAAACTGG -3'
(R):5'- TAATGGCTCAGGACCGCCTTTC -3'
Posted On2017-08-16