Incidental Mutation 'R6111:Olfr875'
ID484848
Institutional Source Beutler Lab
Gene Symbol Olfr875
Ensembl Gene ENSMUSG00000058628
Gene Nameolfactory receptor 875
SynonymsGA_x6K02T2PVTD-31458511-31459443, MOR161-4
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37771857-37774459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37772932 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 91 (I91T)
Ref Sequence ENSEMBL: ENSMUSP00000150684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080634] [ENSMUST00000215128]
Predicted Effect probably damaging
Transcript: ENSMUST00000080634
AA Change: I91T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079467
Gene: ENSMUSG00000058628
AA Change: I91T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-48 PFAM
Pfam:7tm_1 40 289 1.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215128
AA Change: I91T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Olfr875
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01909:Olfr875 APN 9 37772863 missense possibly damaging 0.95
IGL02013:Olfr875 APN 9 37772889 missense probably benign 0.00
IGL02162:Olfr875 APN 9 37772931 missense probably benign 0.13
IGL02966:Olfr875 APN 9 37773586 missense probably benign 0.28
R0017:Olfr875 UTSW 9 37772978 missense probably benign 0.08
R0520:Olfr875 UTSW 9 37773553 missense probably benign 0.00
R0553:Olfr875 UTSW 9 37773331 missense probably benign 0.05
R0833:Olfr875 UTSW 9 37773076 missense probably benign 0.03
R1316:Olfr875 UTSW 9 37772743 missense possibly damaging 0.94
R1547:Olfr875 UTSW 9 37772664 missense probably benign 0.00
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1891:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1894:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R3055:Olfr875 UTSW 9 37773193 missense probably damaging 1.00
R4816:Olfr875 UTSW 9 37773430 missense possibly damaging 0.72
R4829:Olfr875 UTSW 9 37772947 missense probably damaging 1.00
R4952:Olfr875 UTSW 9 37773064 missense probably damaging 0.99
R6838:Olfr875 UTSW 9 37773052 missense possibly damaging 0.87
R7101:Olfr875 UTSW 9 37772991 missense probably damaging 0.99
R7104:Olfr875 UTSW 9 37773141 missense possibly damaging 0.64
R7224:Olfr875 UTSW 9 37773415 missense possibly damaging 0.95
R7334:Olfr875 UTSW 9 37772997 missense probably damaging 0.97
R7582:Olfr875 UTSW 9 37772821 missense probably damaging 1.00
R7909:Olfr875 UTSW 9 37772737 missense probably damaging 1.00
R7990:Olfr875 UTSW 9 37772737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTCATCCTTGCAGGCC -3'
(R):5'- AGGTCAGATTCATGAGGTTCCC -3'

Sequencing Primer
(F):5'- TCCTTGCAGGCCTGACAAAC -3'
(R):5'- GCTATGCCTCCAGAGAAGC -3'
Posted On2017-08-16