Incidental Mutation 'R6111:Hace1'
ID484853
Institutional Source Beutler Lab
Gene Symbol Hace1
Ensembl Gene ENSMUSG00000038822
Gene NameHECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
SynonymsA730034A22Rik, 1700042J16Rik
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location45577829-45712345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45589510 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 54 (K54I)
Ref Sequence ENSEMBL: ENSMUSP00000039206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037044] [ENSMUST00000131568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037044
AA Change: K54I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039206
Gene: ENSMUSG00000038822
AA Change: K54I

DomainStartEndE-ValueType
ANK 64 93 3.23e-4 SMART
ANK 97 126 7.76e-7 SMART
ANK 130 159 8.26e-2 SMART
ANK 163 192 1.94e-7 SMART
ANK 196 227 1.65e-1 SMART
ANK 228 257 5.98e1 SMART
Blast:HECTc 372 522 7e-87 BLAST
HECTc 572 909 1.76e-138 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131568
AA Change: K32I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121196
Gene: ENSMUSG00000038822
AA Change: K32I

DomainStartEndE-ValueType
Blast:ANK 4 37 2e-15 BLAST
ANK 42 71 3.23e-4 SMART
ANK 75 104 7.76e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142956
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HECT domain and ankyrin repeat-containing ubiquitin ligase. The encoded protein is involved in specific tagging of target proteins, leading to their subcellular localization or proteasomal degradation. The protein is a potential tumor suppressor and is involved in the pathophysiology of several tumors, including Wilm's tumor. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Hace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hace1 APN 10 45672357 nonsense probably null
IGL01456:Hace1 APN 10 45709998 splice site probably benign
IGL02122:Hace1 APN 10 45618604 missense probably damaging 1.00
IGL02217:Hace1 APN 10 45590375 splice site probably null
IGL02493:Hace1 APN 10 45588419 missense probably damaging 0.98
IGL02596:Hace1 APN 10 45700640 missense possibly damaging 0.55
IGL02619:Hace1 APN 10 45671434 unclassified probably benign
IGL03163:Hace1 APN 10 45672605 missense probably damaging 0.97
R0609:Hace1 UTSW 10 45648869 missense probably damaging 1.00
R0853:Hace1 UTSW 10 45648683 missense probably damaging 1.00
R2038:Hace1 UTSW 10 45700625 missense probably benign 0.03
R2212:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R2328:Hace1 UTSW 10 45648945 missense probably benign 0.43
R2881:Hace1 UTSW 10 45671134 missense probably benign 0.10
R3005:Hace1 UTSW 10 45648863 missense probably damaging 0.96
R3414:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R3930:Hace1 UTSW 10 45711508 missense probably benign 0.37
R4014:Hace1 UTSW 10 45588374 splice site probably benign
R4335:Hace1 UTSW 10 45709961 missense probably damaging 0.99
R4547:Hace1 UTSW 10 45672555 unclassified probably null
R4812:Hace1 UTSW 10 45686603 missense probably benign 0.00
R4996:Hace1 UTSW 10 45649950 missense probably benign 0.17
R5858:Hace1 UTSW 10 45711525 missense possibly damaging 0.58
R5995:Hace1 UTSW 10 45670391 missense probably benign 0.00
R6049:Hace1 UTSW 10 45686662 missense probably damaging 1.00
R6195:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6216:Hace1 UTSW 10 45618547 missense probably benign
R6233:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6237:Hace1 UTSW 10 45648890 missense probably benign
R6467:Hace1 UTSW 10 45590266 critical splice acceptor site probably null
R6930:Hace1 UTSW 10 45618502 missense probably damaging 1.00
R7325:Hace1 UTSW 10 45589507 nonsense probably null
R7401:Hace1 UTSW 10 45670626 missense probably damaging 1.00
R7426:Hace1 UTSW 10 45605540 missense probably damaging 1.00
R7471:Hace1 UTSW 10 45700979 missense probably benign 0.06
R7533:Hace1 UTSW 10 45711474 missense probably benign 0.03
R7661:Hace1 UTSW 10 45605553 missense probably damaging 1.00
R7873:Hace1 UTSW 10 45672787 missense possibly damaging 0.92
R7995:Hace1 UTSW 10 45589492 missense probably damaging 1.00
R8017:Hace1 UTSW 10 45638382 missense probably damaging 1.00
R8019:Hace1 UTSW 10 45638382 missense probably damaging 1.00
R8022:Hace1 UTSW 10 45700970 missense probably damaging 1.00
R8292:Hace1 UTSW 10 45711461 nonsense probably null
Z1176:Hace1 UTSW 10 45686662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGTTGTATTGACTGTCATTCTTC -3'
(R):5'- CGCTAACAATTTATGAAGAGCACAGC -3'

Sequencing Primer
(F):5'- CATTCTTCAGATAGACAACTGTTGG -3'
(R):5'- ACAGGACACGGCAGCCTTAG -3'
Posted On2017-08-16