Incidental Mutation 'R6111:Rai1'
ID484855
Institutional Source Beutler Lab
Gene Symbol Rai1
Ensembl Gene ENSMUSG00000062115
Gene Nameretinoic acid induced 1
SynonymsGt1
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location60105013-60199197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60187906 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 932 (M932K)
Ref Sequence ENSEMBL: ENSMUSP00000126183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064190] [ENSMUST00000090806] [ENSMUST00000102688] [ENSMUST00000132012] [ENSMUST00000171108]
Predicted Effect probably damaging
Transcript: ENSMUST00000064190
AA Change: M932K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115
AA Change: M932K

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090806
AA Change: M932K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088315
Gene: ENSMUSG00000062115
AA Change: M932K

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102688
AA Change: M932K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115
AA Change: M932K

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132012
SMART Domains Protein: ENSMUSP00000118543
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149770
Predicted Effect probably damaging
Transcript: ENSMUST00000171108
AA Change: M932K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115
AA Change: M932K

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene usually die as embryos. Survivors have shortened life spans and show severe craniofacial and axial skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Rai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Rai1 APN 11 60185391 missense probably damaging 1.00
IGL00952:Rai1 APN 11 60187992 nonsense probably null
IGL01118:Rai1 APN 11 60187438 missense probably damaging 0.98
IGL02540:Rai1 APN 11 60186924 missense probably benign 0.09
IGL02624:Rai1 APN 11 60188743 missense probably damaging 1.00
IGL02696:Rai1 APN 11 60193956 missense probably benign
IGL02940:Rai1 APN 11 60187018 missense probably benign 0.03
IGL02970:Rai1 APN 11 60185733 missense probably damaging 1.00
IGL03006:Rai1 APN 11 60188205 missense possibly damaging 0.95
R0557:Rai1 UTSW 11 60190495 missense probably benign 0.00
R1438:Rai1 UTSW 11 60185395 missense probably benign 0.00
R1712:Rai1 UTSW 11 60187602 missense probably benign
R1837:Rai1 UTSW 11 60189398 missense probably damaging 1.00
R1899:Rai1 UTSW 11 60185920 missense probably benign 0.16
R2024:Rai1 UTSW 11 60185589 missense probably damaging 0.99
R2141:Rai1 UTSW 11 60189467 missense possibly damaging 0.94
R2168:Rai1 UTSW 11 60187596 missense probably benign 0.01
R2404:Rai1 UTSW 11 60189924 missense probably benign
R4869:Rai1 UTSW 11 60186762 missense probably damaging 1.00
R4894:Rai1 UTSW 11 60186746 missense probably damaging 1.00
R5082:Rai1 UTSW 11 60185919 missense possibly damaging 0.48
R5093:Rai1 UTSW 11 60188656 missense probably benign 0.00
R5221:Rai1 UTSW 11 60190597 missense probably damaging 1.00
R5503:Rai1 UTSW 11 60186453 missense probably benign 0.00
R5587:Rai1 UTSW 11 60189859 missense probably damaging 1.00
R5849:Rai1 UTSW 11 60190521 missense possibly damaging 0.90
R5914:Rai1 UTSW 11 60187804 missense probably benign
R5950:Rai1 UTSW 11 60187593 missense probably damaging 1.00
R6450:Rai1 UTSW 11 60186603 missense probably benign 0.30
R6785:Rai1 UTSW 11 60188794 missense probably benign
R6889:Rai1 UTSW 11 60185715 missense probably damaging 1.00
R7296:Rai1 UTSW 11 60188673 missense probably benign 0.39
R7388:Rai1 UTSW 11 60189375 missense possibly damaging 0.46
R8196:Rai1 UTSW 11 60185970 missense probably damaging 1.00
X0018:Rai1 UTSW 11 60186436 missense probably benign 0.03
X0019:Rai1 UTSW 11 60189940 missense probably benign 0.14
X0024:Rai1 UTSW 11 60187395 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGTACTCTTCTCTGTGTGAACTGC -3'
(R):5'- TCTTTGGGAAGTGCTGGCAC -3'

Sequencing Primer
(F):5'- GACCCGTTGTCCCCAAAG -3'
(R):5'- ACCCTGCACGGAGAGTCTTC -3'
Posted On2017-08-16