Incidental Mutation 'R6111:Zfp72'
ID484861
Institutional Source Beutler Lab
Gene Symbol Zfp72
Ensembl Gene ENSMUSG00000069184
Gene Namezinc finger protein 72
SynonymsZfp74
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74369326-74390836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74372385 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 191 (E191D)
Ref Sequence ENSEMBL: ENSMUSP00000152502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091481] [ENSMUST00000223163]
Predicted Effect probably benign
Transcript: ENSMUST00000091481
AA Change: E191D

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089063
Gene: ENSMUSG00000069184
AA Change: E191D

DomainStartEndE-ValueType
KRAB 1 32 3.57e-1 SMART
ZnF_C2H2 48 70 5.42e-2 SMART
ZnF_C2H2 76 98 1.18e-2 SMART
ZnF_C2H2 104 126 2.05e-2 SMART
ZnF_C2H2 132 154 2.3e-5 SMART
ZnF_C2H2 160 181 2.45e0 SMART
ZnF_C2H2 187 209 1.92e-2 SMART
ZnF_C2H2 215 237 5.59e-4 SMART
ZnF_C2H2 243 265 4.87e-4 SMART
ZnF_C2H2 271 293 4.94e-5 SMART
ZnF_C2H2 299 321 9.08e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
ZnF_C2H2 355 377 3.16e-3 SMART
ZnF_C2H2 383 405 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223163
AA Change: E191D

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Zfp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0653:Zfp72 UTSW 13 74372071 missense probably damaging 1.00
R0711:Zfp72 UTSW 13 74376425 splice site probably benign
R1498:Zfp72 UTSW 13 74372617 missense probably benign 0.01
R4032:Zfp72 UTSW 13 74372330 missense possibly damaging 0.62
R4629:Zfp72 UTSW 13 74372393 missense probably damaging 1.00
R6130:Zfp72 UTSW 13 74372341 missense possibly damaging 0.75
R6277:Zfp72 UTSW 13 74372524 nonsense probably null
R6800:Zfp72 UTSW 13 74371961 missense probably benign 0.00
R6909:Zfp72 UTSW 13 74371742 missense possibly damaging 0.47
R7298:Zfp72 UTSW 13 74372394 missense possibly damaging 0.93
R7330:Zfp72 UTSW 13 74375034 missense probably damaging 0.99
R7341:Zfp72 UTSW 13 74372348 missense possibly damaging 0.68
RF014:Zfp72 UTSW 13 74375054 missense probably benign 0.17
Z1177:Zfp72 UTSW 13 74371792 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCACTCATAAGGTTTCTCTCC -3'
(R):5'- ACCCTACAAATGTGAACAGTGTG -3'

Sequencing Primer
(F):5'- CCACATTCGCTGCATTTGTAGGG -3'
(R):5'- CATCAGAGAATTCACACTGGTG -3'
Posted On2017-08-16