Incidental Mutation 'R6111:2210408I21Rik'
ID484862
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77327902 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1110 (E1110G)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: E1110G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: E1110G

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R7964:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
R8170:2210408I21Rik UTSW 13 77263594 missense probably benign 0.06
R8201:2210408I21Rik UTSW 13 77193159 missense possibly damaging 0.72
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGCTTTCAGGTGCTTCGTC -3'
(R):5'- ACTAACCCTTAGCTGCCAGC -3'

Sequencing Primer
(F):5'- TCAGGTGCTTCGTCCCCAG -3'
(R):5'- ACCTCATTGAGCTGCATG -3'
Posted On2017-08-16