Incidental Mutation 'R6111:Tnfrsf10b'
ID484867
Institutional Source Beutler Lab
Gene Symbol Tnfrsf10b
Ensembl Gene ENSMUSG00000022074
Gene Nametumor necrosis factor receptor superfamily, member 10b
SynonymsKILLER, Trail Receptor, TRICK2A, Ly98, TRAIL-R2, Killer/Dr5, TRAILR2, TRICKB, TRICK2B, DR5
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6111 (G1)
Quality Score219.009
Status Validated
Chromosome14
Chromosomal Location69767472-69784411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69782558 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 380 (C380S)
Ref Sequence ENSEMBL: ENSMUSP00000022663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022663] [ENSMUST00000022665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022663
AA Change: C380S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022663
Gene: ENSMUSG00000022074
AA Change: C380S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
TNFR 88 129 3.17e-7 SMART
TNFR 131 169 4.73e-6 SMART
transmembrane domain 182 201 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
DEATH 262 356 7e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022665
SMART Domains Protein: ENSMUSP00000022665
Gene: ENSMUSG00000022075

DomainStartEndE-ValueType
RHO 17 210 4.86e-36 SMART
low complexity region 227 249 N/A INTRINSIC
BTB 266 472 5.27e-15 SMART
BTB 500 598 2.78e-14 SMART
low complexity region 706 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224533
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit enhanced innate immune responses, including increased clearance of cytomegalovirus and increased levels of IL-12, IFN-alpha and IFN-gamma after viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Tnfrsf10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02525:Tnfrsf10b APN 14 69782376 missense probably damaging 1.00
R0650:Tnfrsf10b UTSW 14 69776176 missense probably damaging 0.98
R2102:Tnfrsf10b UTSW 14 69776097 missense probably benign 0.42
R3870:Tnfrsf10b UTSW 14 69773456 missense probably benign 0.03
R4840:Tnfrsf10b UTSW 14 69776159 missense probably damaging 0.98
R6351:Tnfrsf10b UTSW 14 69773401 missense probably damaging 1.00
R7853:Tnfrsf10b UTSW 14 69767790 missense unknown
R7936:Tnfrsf10b UTSW 14 69767790 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCTGTACCAAATGCTGCTC -3'
(R):5'- TCTCAGAGGTTCTGTGTTCAACTTC -3'

Sequencing Primer
(F):5'- CTGTACCAAATGCTGCTCAAGTGG -3'
(R):5'- AGGTTCTGTGTTCAACTTCTAATAAG -3'
Posted On2017-08-16