Mutagenetix > Incidental Mutation

Incidental Mutation 'R6111:Espl1'

484870

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

044260-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6111 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102299888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 443 (E443G)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: E443G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: E443G

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: E443G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229580

Predicted Effect

probably benign
Transcript: ENSMUST00000230212

Predicted Effect

probably benign
Transcript: ENSMUST00000231104

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	T	C	14: 32,806,798	I40T	possibly damaging	Het
2210408I21Rik	A	G	13: 77,327,902	E1110G	possibly damaging	Het
Abcd4	G	A	12: 84,615,114	T79I	probably damaging	Het
Acd	A	G	8: 105,698,287	M407T	probably benign	Het
Adcy2	T	A	13: 68,729,241	H460L	probably damaging	Het
Arntl2	T	C	6: 146,820,599	F223L	probably benign	Het
Atad2	G	A	15: 58,108,091	H752Y	probably benign	Het
Camsap2	A	G	1: 136,281,298	S819P	probably benign	Het
Col24a1	C	A	3: 145,314,054	T62K	probably damaging	Het
Cpne6	G	A	14: 55,514,634	V283M	probably benign	Het
D630003M21Rik	A	G	2: 158,213,448	S590P	probably damaging	Het
Daam1	T	A	12: 71,942,264	M146K	unknown	Het
Dclk2	A	G	3: 86,805,661	Y495H	probably benign	Het
Ddx4	A	T	13: 112,621,232	C330*	probably null	Het
Dlec1	T	C	9: 119,102,624	L37P	possibly damaging	Het
Dock2	G	A	11: 34,708,787	P322S	probably damaging	Het
Eya4	T	A	10: 23,140,055	D338V	possibly damaging	Het
Fcmr	A	G	1: 130,877,829	I267V	probably damaging	Het
Gfra3	T	A	18: 34,690,874	H349L	probably damaging	Het
Gm25747	A	G	12: 113,429,083		probably benign	Het
Gria4	G	A	9: 4,502,430	R368C	probably damaging	Het
H2-Q5	A	T	17: 35,394,909	I145F	possibly damaging	Het
Hace1	A	T	10: 45,589,510	K54I	possibly damaging	Het
Ift122	T	A	6: 115,875,286	I79N	probably damaging	Het
Ino80b	A	G	6: 83,124,366	V121A	probably damaging	Het
Kcnq1	A	G	7: 143,107,737	T63A	probably benign	Het
Map4k4	C	A	1: 40,011,662	Q762K	probably benign	Het
Mios	G	A	6: 8,214,836	A11T	probably benign	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Notch2	T	C	3: 98,146,293	S2091P	probably benign	Het
Nudt19	T	A	7: 35,555,527	D93V	probably benign	Het
Olfr875	T	C	9: 37,772,932	I91T	probably damaging	Het
Osbpl2	A	G	2: 180,150,201	T233A	probably benign	Het
P3h1	C	T	4: 119,241,132	R369*	probably null	Het
Pcdhb3	A	T	18: 37,302,189	I403L	probably benign	Het
Pigo	T	C	4: 43,019,724	D935G	probably benign	Het
Plpp1	A	G	13: 112,866,917	H224R	probably damaging	Het
Rai1	T	A	11: 60,187,906	M932K	probably damaging	Het
Rexo2	A	T	9: 48,473,112	F122L	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Sdc3	A	G	4: 130,818,842	T77A	unknown	Het
Skint5	T	C	4: 113,705,648	T786A	unknown	Het
Smok3c	C	A	5: 138,065,103	P284Q	probably damaging	Het
Spg11	A	G	2: 122,093,482	V786A	probably damaging	Het
Tnfrsf10b	T	A	14: 69,782,558	C380S	possibly damaging	Het
Tsen54	T	C	11: 115,820,130	V176A	possibly damaging	Het
Ttll4	A	T	1: 74,697,539	K1141M	possibly damaging	Het
Ttpa	A	T	4: 20,014,772	I116F	probably damaging	Het
Tubgcp6	T	C	15: 89,100,920	D1655G	possibly damaging	Het
Usp38	A	G	8: 81,013,922	V172A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Wdr72	T	C	9: 74,210,325	M773T	probably benign	Het
Xirp2	T	A	2: 67,511,817	H1467Q	possibly damaging	Het
Zdhhc8	G	T	16: 18,224,898	S479R	probably damaging	Het
Zfp423	A	G	8: 87,782,687	V322A	probably damaging	Het
Zfp72	T	G	13: 74,372,385	E191D	probably benign	Het
Zfp933	T	C	4: 147,828,760	T14A	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGACATTCTGAGGTTGCTTC -3'
(R):5'- AGAATTCTCTGTCCTAAGCCTCAC -3'

Sequencing Primer
(F):5'- CAGCCTCTATAGAGTGAGTTCCAG -3'
(R):5'- CGTCTCTCCTGCATTAATCAGATC -3'

Posted On

2017-08-16