Incidental Mutation 'R6111:Gfra3'
ID484873
Institutional Source Beutler Lab
Gene Symbol Gfra3
Ensembl Gene ENSMUSG00000024366
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 3
SynonymsGFRalpha3, GFR alpha-3
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34689903-34720387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34690874 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 349 (H349L)
Ref Sequence ENSEMBL: ENSMUSP00000025224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025224]
Predicted Effect probably damaging
Transcript: ENSMUST00000025224
AA Change: H349L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025224
Gene: ENSMUSG00000024366
AA Change: H349L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
GDNF 41 122 1.33e-15 SMART
GDNF 159 236 5.57e-18 SMART
GDNF 245 337 9.84e-28 SMART
low complexity region 380 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the glial cell line-derived neurotrophic receptor (GDNFR) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein mediates binding of the ligand artemin to the ret receptor tyrosine kinase, and this interaction may regulate thermal pain and axon regeneration. Homozygous knockout mice for this gene exhibit impaired proliferation of cultured neuroblasts and impaired development of the superior cervical ganglion. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display ptosis and poor development of the sympathetic chain ganglia and associated nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Gfra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Gfra3 APN 18 34691548 critical splice donor site probably null
IGL01778:Gfra3 APN 18 34691591 missense possibly damaging 0.65
IGL02051:Gfra3 APN 18 34695841 missense possibly damaging 0.95
R0107:Gfra3 UTSW 18 34711306 missense probably benign 0.04
R0573:Gfra3 UTSW 18 34691615 missense probably benign
R1029:Gfra3 UTSW 18 34690839 missense probably benign 0.01
R1870:Gfra3 UTSW 18 34711320 missense probably damaging 0.97
R2512:Gfra3 UTSW 18 34704511 missense probably benign 0.04
R4689:Gfra3 UTSW 18 34690587 missense unknown
R4801:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4802:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4884:Gfra3 UTSW 18 34711251 missense probably benign 0.00
R5824:Gfra3 UTSW 18 34711211 missense probably damaging 1.00
R6192:Gfra3 UTSW 18 34704529 missense possibly damaging 0.87
R6228:Gfra3 UTSW 18 34695793 missense probably damaging 1.00
R6251:Gfra3 UTSW 18 34695811 frame shift probably null
R6759:Gfra3 UTSW 18 34695873 nonsense probably null
R6781:Gfra3 UTSW 18 34711322 missense possibly damaging 0.56
R6894:Gfra3 UTSW 18 34695657 missense probably damaging 1.00
R7021:Gfra3 UTSW 18 34690880 missense probably benign 0.00
R7232:Gfra3 UTSW 18 34711181 missense probably damaging 1.00
R7236:Gfra3 UTSW 18 34695831 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAAGCCTAAGGGAAGAGTCG -3'
(R):5'- ACTTGCTCAACTTGTCTAAGCC -3'

Sequencing Primer
(F):5'- GAAGAGTCGTGACTGTCCCCTTC -3'
(R):5'- CTTGTCTAAGCCCTAAGAACTGG -3'
Posted On2017-08-16