Incidental Mutation 'R6112:Cfap65'
ID484876
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R6112 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74903139 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1752 (I1752T)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083682
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: I1752T

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: I1752T

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160540
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Arhgap20 T C 9: 51,829,384 Y219H probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cacna1g C T 11: 94,409,246 A2216T probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Ift172 T C 5: 31,256,897 T1435A probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lcor T C 19: 41,559,081 V368A possibly damaging Het
Lmna C A 3: 88,486,621 E217* probably null Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Radil C T 5: 142,543,644 R99H probably damaging Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACACAAAGCTGGGTTCTG -3'
(R):5'- ACTTAGTGCCGATCCTGTCC -3'

Sequencing Primer
(F):5'- ACAAAGCTGGGTTCTGCTCTTC -3'
(R):5'- ACCTTTTTGGGAAGATGCCAG -3'
Posted On2017-08-16