Incidental Mutation 'R6112:Lmna'
ID484891
Institutional Source Beutler Lab
Gene Symbol Lmna
Ensembl Gene ENSMUSG00000028063
Gene Namelamin A
SynonymsDhe, lamin A/C
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6112 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88480147-88509956 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 88486621 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 217 (E217*)
Ref Sequence ENSEMBL: ENSMUSP00000113093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029699] [ENSMUST00000036252] [ENSMUST00000120377]
Predicted Effect probably null
Transcript: ENSMUST00000029699
AA Change: E217*
SMART Domains Protein: ENSMUSP00000029699
Gene: ENSMUSG00000028063
AA Change: E217*

DomainStartEndE-ValueType
Filament 30 386 4.38e-45 SMART
low complexity region 395 414 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
Pfam:LTD 433 544 4e-15 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 600 639 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000036252
AA Change: E105*
SMART Domains Protein: ENSMUSP00000040265
Gene: ENSMUSG00000028063
AA Change: E105*

DomainStartEndE-ValueType
Pfam:Filament 2 274 5.6e-66 PFAM
low complexity region 283 302 N/A INTRINSIC
Pfam:LTD 317 436 1.2e-22 PFAM
low complexity region 439 450 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120377
AA Change: E217*
SMART Domains Protein: ENSMUSP00000113093
Gene: ENSMUSG00000028063
AA Change: E217*

DomainStartEndE-ValueType
Pfam:Filament 30 386 1.3e-95 PFAM
low complexity region 395 414 N/A INTRINSIC
Pfam:LTD 429 548 1.7e-22 PFAM
low complexity region 551 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150496
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the lamin family. Nuclear lamins, intermediate filament-like proteins, are the major components of the nuclear lamina, a protein meshwork associated with the inner nuclear membrane. This meshwork is thought to maintain the integrity of the nuclear envelope, participate in chromatin organization, and regulate gene transcription. Vertebrate lamins consist of two types, A and B. This protein is an A-type and is proposed to be developmentally regulated. In mouse deficiency of this gene is associated with muscular dystrophy. Mouse lines with different mutations in this gene serve as pathophysiological models for several human laminopathies. In humans, mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit retarded postnatal growth, muscular dystrophy, reduced fat stores, micrognathy, abnormal dentition, impaired gonadal development, malformed scapulae, hyperkeratosis, and die by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Arhgap20 T C 9: 51,829,384 Y219H probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cacna1g C T 11: 94,409,246 A2216T probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Cfap65 A G 1: 74,903,139 I1752T probably benign Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Ift172 T C 5: 31,256,897 T1435A probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lcor T C 19: 41,559,081 V368A possibly damaging Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Radil C T 5: 142,543,644 R99H probably damaging Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Lmna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lmna APN 3 88484684 missense probably benign 0.05
IGL00933:Lmna APN 3 88482549 missense possibly damaging 0.73
IGL01347:Lmna APN 3 88484963 missense probably benign 0.42
IGL02881:Lmna APN 3 88502926 missense possibly damaging 0.56
P0029:Lmna UTSW 3 88483917 missense possibly damaging 0.88
R0606:Lmna UTSW 3 88482578 missense probably damaging 1.00
R1547:Lmna UTSW 3 88482351 missense probably benign 0.00
R4751:Lmna UTSW 3 88486533 missense possibly damaging 0.87
R5157:Lmna UTSW 3 88484107 missense probably damaging 1.00
R5857:Lmna UTSW 3 88482531 unclassified probably benign
R6263:Lmna UTSW 3 88502958 missense probably damaging 1.00
R6328:Lmna UTSW 3 88486506 missense probably damaging 1.00
R6604:Lmna UTSW 3 88488282 missense probably damaging 0.97
R7100:Lmna UTSW 3 88484990 missense probably damaging 0.99
R8080:Lmna UTSW 3 88486561 missense probably damaging 0.99
RF013:Lmna UTSW 3 88484054 missense probably benign 0.00
Z1177:Lmna UTSW 3 88486236 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAGTTATGAGAGCAGGAACCTG -3'
(R):5'- TTACAGCGAGGTAAGCGTCC -3'

Sequencing Primer
(F):5'- GCAGGAACCTGGAGCTG -3'
(R):5'- GTCCCGCTGTACAGGTCTTTC -3'
Posted On2017-08-16