Incidental Mutation 'R6112:Radil'
ID484898
Institutional Source Beutler Lab
Gene Symbol Radil
Ensembl Gene ENSMUSG00000029576
Gene NameRas association and DIL domains
SynonymsD930005D10Rik
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6112 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142484839-142551098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142543644 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 99 (R99H)
Ref Sequence ENSEMBL: ENSMUSP00000115800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063635] [ENSMUST00000085758] [ENSMUST00000110785] [ENSMUST00000129212]
Predicted Effect probably damaging
Transcript: ENSMUST00000063635
AA Change: R99H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064539
Gene: ENSMUSG00000029576
AA Change: R99H

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 950 964 N/A INTRINSIC
PDZ 979 1056 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085758
AA Change: R128H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082910
Gene: ENSMUSG00000029576
AA Change: R128H

DomainStartEndE-ValueType
RA 90 193 1.68e-15 SMART
Blast:FHA 294 361 2e-25 BLAST
low complexity region 373 383 N/A INTRINSIC
low complexity region 579 589 N/A INTRINSIC
DIL 663 772 6.19e-34 SMART
low complexity region 979 993 N/A INTRINSIC
PDZ 1008 1085 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110785
AA Change: R99H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106412
Gene: ENSMUSG00000029576
AA Change: R99H

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 973 987 N/A INTRINSIC
PDZ 1002 1079 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129212
AA Change: R99H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115800
Gene: ENSMUSG00000029576
AA Change: R99H

DomainStartEndE-ValueType
Pfam:RA 61 107 5.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139824
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Arhgap20 T C 9: 51,829,384 Y219H probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cacna1g C T 11: 94,409,246 A2216T probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Cfap65 A G 1: 74,903,139 I1752T probably benign Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Ift172 T C 5: 31,256,897 T1435A probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lcor T C 19: 41,559,081 V368A possibly damaging Het
Lmna C A 3: 88,486,621 E217* probably null Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Radil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Radil APN 5 142497922 missense probably damaging 0.99
IGL01359:Radil APN 5 142543713 missense probably damaging 0.98
IGL01714:Radil APN 5 142543397 unclassified probably benign
IGL02086:Radil APN 5 142543821 missense probably benign 0.28
IGL02250:Radil APN 5 142543774 missense probably damaging 1.00
IGL02296:Radil APN 5 142506463 missense probably benign 0.10
IGL02890:Radil APN 5 142543708 missense probably damaging 1.00
IGL02978:Radil APN 5 142494919 missense probably benign 0.00
IGL03131:Radil APN 5 142495342 missense probably damaging 1.00
R0362:Radil UTSW 5 142543827 missense probably benign 0.00
R0389:Radil UTSW 5 142543471 missense probably damaging 0.98
R0426:Radil UTSW 5 142497873 missense probably damaging 1.00
R1753:Radil UTSW 5 142495336 missense probably damaging 1.00
R2168:Radil UTSW 5 142506963 missense probably benign 0.00
R3055:Radil UTSW 5 142495406 missense possibly damaging 0.77
R3177:Radil UTSW 5 142506856 missense probably damaging 1.00
R3277:Radil UTSW 5 142506856 missense probably damaging 1.00
R3851:Radil UTSW 5 142506997 missense probably damaging 1.00
R4043:Radil UTSW 5 142494233 missense probably benign 0.31
R4245:Radil UTSW 5 142543791 missense probably damaging 1.00
R4367:Radil UTSW 5 142494805 missense probably benign 0.06
R4697:Radil UTSW 5 142486801 missense probably benign
R4798:Radil UTSW 5 142485163 missense probably benign 0.39
R4948:Radil UTSW 5 142485239 missense probably benign 0.02
R5407:Radil UTSW 5 142508215 missense probably damaging 1.00
R5784:Radil UTSW 5 142487513 missense possibly damaging 0.88
R5918:Radil UTSW 5 142487602 missense probably benign 0.43
R5943:Radil UTSW 5 142485458 missense probably damaging 1.00
R6147:Radil UTSW 5 142497940 missense probably benign 0.01
R6174:Radil UTSW 5 142487115 missense probably benign
R6241:Radil UTSW 5 142494942 missense probably damaging 1.00
R6874:Radil UTSW 5 142506802 missense probably damaging 1.00
R6881:Radil UTSW 5 142486917 missense probably benign 0.00
R7056:Radil UTSW 5 142494354 nonsense probably null
R7134:Radil UTSW 5 142485549 missense probably damaging 1.00
R7167:Radil UTSW 5 142485505 synonymous probably null
R7374:Radil UTSW 5 142485480 missense probably damaging 1.00
R7482:Radil UTSW 5 142486763 missense probably benign
R7607:Radil UTSW 5 142494795 missense probably damaging 0.98
R7607:Radil UTSW 5 142506613 missense probably damaging 0.99
R7777:Radil UTSW 5 142543548 missense probably damaging 1.00
R7779:Radil UTSW 5 142487565 missense probably benign 0.03
R8047:Radil UTSW 5 142494940 missense probably damaging 1.00
R8123:Radil UTSW 5 142487620 missense probably damaging 0.99
X0058:Radil UTSW 5 142487514 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CGATGCAAGCTCTTCCACATC -3'
(R):5'- GTGACCTGGATTCCACCTTC -3'

Sequencing Primer
(F):5'- CTTAGCTCAAACCTCCGGG -3'
(R):5'- ACCTTCTGCAGCCTAGGTG -3'
Posted On2017-08-16