Incidental Mutation 'R6112:Arhgap20'
ID484911
Institutional Source Beutler Lab
Gene Symbol Arhgap20
Ensembl Gene ENSMUSG00000053199
Gene NameRho GTPase activating protein 20
Synonyms6530403F17Rik, A530023E23Rik
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R6112 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location51765337-51853856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51829384 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 219 (Y219H)
Ref Sequence ENSEMBL: ENSMUSP00000120124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065496] [ENSMUST00000130405]
Predicted Effect probably damaging
Transcript: ENSMUST00000065496
AA Change: Y255H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065633
Gene: ENSMUSG00000053199
AA Change: Y255H

DomainStartEndE-ValueType
PH 86 187 3.31e-5 SMART
Pfam:RA 194 283 3.6e-15 PFAM
RhoGAP 374 548 1.27e-41 SMART
internal_repeat_1 655 779 9.97e-15 PROSPERO
internal_repeat_1 797 922 9.97e-15 PROSPERO
low complexity region 935 962 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126567
Predicted Effect probably damaging
Transcript: ENSMUST00000130405
AA Change: Y219H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120124
Gene: ENSMUSG00000053199
AA Change: Y219H

DomainStartEndE-ValueType
PH 50 151 3.31e-5 SMART
Pfam:RA 158 247 3.3e-14 PFAM
RhoGAP 338 512 1.27e-41 SMART
internal_repeat_1 619 743 7.07e-15 PROSPERO
internal_repeat_1 761 886 7.07e-15 PROSPERO
low complexity region 899 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152203
Meta Mutation Damage Score 0.1534 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of RHO-type GTPases, transducing a signal from RAP1 to RHO and impacting neurite outgrowth. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cacna1g C T 11: 94,409,246 A2216T probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Cfap65 A G 1: 74,903,139 I1752T probably benign Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Ift172 T C 5: 31,256,897 T1435A probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lcor T C 19: 41,559,081 V368A possibly damaging Het
Lmna C A 3: 88,486,621 E217* probably null Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Radil C T 5: 142,543,644 R99H probably damaging Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Arhgap20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Arhgap20 APN 9 51849413 missense probably benign 0.00
IGL01542:Arhgap20 APN 9 51838887 missense probably benign
IGL01815:Arhgap20 APN 9 51846168 missense probably damaging 1.00
IGL01975:Arhgap20 APN 9 51849797 nonsense probably null
IGL02041:Arhgap20 APN 9 51846190 missense possibly damaging 0.92
IGL02557:Arhgap20 APN 9 51821273 missense probably damaging 1.00
IGL02602:Arhgap20 APN 9 51825843 missense probably damaging 1.00
IGL02741:Arhgap20 APN 9 51848645 missense probably benign 0.17
IGL02792:Arhgap20 APN 9 51849918 missense possibly damaging 0.89
IGL03166:Arhgap20 APN 9 51849777 missense possibly damaging 0.63
P0047:Arhgap20 UTSW 9 51849236 missense probably damaging 1.00
R0115:Arhgap20 UTSW 9 51838972 missense probably damaging 1.00
R0121:Arhgap20 UTSW 9 51838951 missense possibly damaging 0.91
R0539:Arhgap20 UTSW 9 51850155 missense probably benign 0.01
R0541:Arhgap20 UTSW 9 51849663 missense probably damaging 1.00
R0551:Arhgap20 UTSW 9 51825825 splice site probably benign
R0570:Arhgap20 UTSW 9 51840451 missense possibly damaging 0.56
R0630:Arhgap20 UTSW 9 51849384 missense probably damaging 0.98
R0931:Arhgap20 UTSW 9 51816741 missense probably benign 0.30
R0992:Arhgap20 UTSW 9 51816786 missense probably damaging 0.96
R1052:Arhgap20 UTSW 9 51846270 missense probably damaging 0.98
R1779:Arhgap20 UTSW 9 51849915 missense probably benign
R1839:Arhgap20 UTSW 9 51849326 missense probably damaging 0.99
R1942:Arhgap20 UTSW 9 51831698 missense probably benign 0.43
R2292:Arhgap20 UTSW 9 51849443 missense possibly damaging 0.63
R3896:Arhgap20 UTSW 9 51816837 missense probably damaging 0.96
R4109:Arhgap20 UTSW 9 51816685 missense possibly damaging 0.60
R4166:Arhgap20 UTSW 9 51826835 critical splice acceptor site probably null
R4631:Arhgap20 UTSW 9 51840353 intron probably benign
R4692:Arhgap20 UTSW 9 51785788 missense probably damaging 1.00
R5273:Arhgap20 UTSW 9 51848616 missense probably damaging 1.00
R5505:Arhgap20 UTSW 9 51838948 missense probably damaging 0.98
R5743:Arhgap20 UTSW 9 51816727 missense probably benign 0.17
R5847:Arhgap20 UTSW 9 51824976 intron probably benign
R6006:Arhgap20 UTSW 9 51850126 missense probably benign
R6355:Arhgap20 UTSW 9 51843720 missense probably damaging 1.00
R6576:Arhgap20 UTSW 9 51849278 missense probably benign 0.03
R6801:Arhgap20 UTSW 9 51848592 missense probably damaging 1.00
R7130:Arhgap20 UTSW 9 51849747 missense probably damaging 0.98
R7318:Arhgap20 UTSW 9 51840502 missense probably benign
R7347:Arhgap20 UTSW 9 51849035 missense probably benign 0.07
R7500:Arhgap20 UTSW 9 51840502 missense probably benign
R7598:Arhgap20 UTSW 9 51849790 missense possibly damaging 0.95
R7677:Arhgap20 UTSW 9 51840398 missense probably damaging 0.97
R7725:Arhgap20 UTSW 9 51831750 missense possibly damaging 0.80
R8086:Arhgap20 UTSW 9 51849263 missense probably benign 0.00
R8122:Arhgap20 UTSW 9 51849993 missense probably damaging 0.99
R8125:Arhgap20 UTSW 9 51826909 missense probably damaging 0.99
Z1177:Arhgap20 UTSW 9 51824924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAATGAGTACTACTACCCCGC -3'
(R):5'- AAAGGCTTGGTAAGATCTGCTTG -3'

Sequencing Primer
(F):5'- GAGTACTACTACCCCGCCCAAG -3'
(R):5'- AGGCTTGGTAAGATCTGCTTGTAAAG -3'
Posted On2017-08-16